micro rnas in neurodegenerative disorders

专利摘要:
micro rnas in neurodegenerative disorders. methods for diagnosing neurodegenerative disorders (e.g., amyotrophic lateral sclerosis and multiple sclerosis) in an individual, for identifying individuals at risk of developing a neurodegenerative disorder, predicting the rate of disease progression in an individual who has a neurodegenerative disorder, the selection of a subject for treatment of a neurodegenerative disorder, the selection of a subject for participation in a clinical trial, and for determining the effectiveness of treatment of a neurodegenerative disorder. methods include determining the level of one or more microRNAs and/or one or more inflammatory markers in a monocyte (e.g., a cd14+cd16- or a cd14+cd16-monocyte) or in the subject's cerebrospinal fluid (csf) and comparison the level of one or more microRNAs and/or the level of one or more inflammatory markers with a reference level(s). Also provided are methods for treating a neurodegenerative disorder including administering to a subject at least one agent that decreases or increases the level or activity of one or more microRNAs or one or more inflammatory markers on a monocyte (e.g., a cd14 +cd16- or a cd14+cd16-monocyte) or in the csf of an individual.
公开号:BR112014008925A2
申请号:R112014008925-6
申请日:2012-10-11
公开日:2020-10-27
发明作者:Howard Weiner；Oleg Butovsky
申请人:The Brigham And Women's Hospital, Inc.；
IPC主号:

专利说明:

[001] [001] This application claims priority to US Provisional Patent Application No. 61/545,968, filed October 11, 2011 and US Provisional Patent Application No. 61/601,205, filed February 21, 2012, each of which is incorporated herein by reference in its entirety. Background of the Invention
[002] [002] Inflammation has been implicated in a number of neurodegenerative disorders (eg, amyotrophic lateral sclerosis (ALS) and multiple sclerosis). For example, enhanced inflammatory responses have been observed in human models of ALS patients and ALS animals (McGreer et al., Muscle Nerve 26:459-470, 2002; Beers et al., Proc. Natl. Acad. Sci. USA). 105:15558-15563, 2008; Banerjee et al., PLoS ONE 3:e2740, 2008; Chiu et al., Proc. Natl. Acad. Sci. USA 105:17913-17918, 2008; Chiu et al., Proc. Natl. Acad. Sci. USA 106:20960-20965, 2009; Beers et al., Proc. Natl. Acad. Sci. USA 103:16021-16026, 2006; Henkel et al., Ann Neurol 55: 221-235, 2004; Meissner et al., Proc. Natl. Acad. Sci. USA 107:13046-13050, 2010 ). Microglia and astrocytes have been reported to be activated in the central nervous system in a mouse model of familial ALS (Alexianu et al., Neurology 57:1282-1289, 2001; Hall et al., Glia 23:249- 256, 1998) and that natural killer cells peripheral T cells infiltrate the spinal cord during neurodegenerative disease progression in a mouse model of ALS (Chiu et al., Proc. Natl. Acad. Sci. USA 105: 17913-17918, 2008).
[003] [003] In the peripheral nervous system, degeneration of peripheral motor axons is an early and significant pathological feature in patients with ALS and in animal models with ALS and is preceded by
[004] [004] The invention is based, at least in part, on the finding that specific microRNAs and inflammatory marker genes are increased or decreased in the cerebrospinal fluid (CSF) and in the CD14+CD16+ and CD14+CD16- monocytes of individuals who have neurodegenerative diseases compared to the expression level of these microRNAs and these inflammatory marker genes in CSF and in CD14+CD16+ and CD14+CD16- monocytes of healthy individuals. Specific microRNAs and inflammatory marker genes that have been identified as being increased or decreased on CSF and/or CD14+CD16+ and/or CD14+CD16- monocytes in individuals who have a neurodegenerative disease are listed in Tables 1-21. Inflammatory markers as described herein are listed in Tables 20 and 21.
[005] [005] Here are provided methods of diagnosing a neurodegenerative disorder (e.g., amyotrophic lateral sclerosis or multiple sclerosis) in an individual, which include determining a level of one or more microRNAs and/or of one or more inflammatory markers listed in one or more of Tables 1-21 in a monocyte (e.g., CD14+CD16+ and CD14+CD16- monocyte) or in the subject's CSF and comparison of the level of one or more microRNAs and/or one or more more inflammatory markers at a reference level of one or more microRNAs and/or of one or more inflammatory markers (for example, a threshold level or a level present in CSF or a CD14+CD16+ and CD14+CD16- monocyte of a healthy individual). In these methods, an increase or decrease in the level of one or more microRNAs and/or of one or more inflammatory markers relative to the reference level indicates that the individual has a neurodegenerative disorder.
[006] [006] Also provided are methods of identifying an individual at risk of developing a neurodegenerative disorder (e.g., amyotrophic lateral sclerosis or multiple sclerosis) that include determining a level of one or more microRNAs and/or of one or more inflammatory markers listed in one or more of Tables 1-21 in a monocyte (eg, CD14+CD16+ and CD14+CD16- monocyte (eg, a peripheral or blood-derived monocyte) or in the individual's CSF and comparison from the level of one or more microRNAs and/or one or more inflammatory markers to a reference level of one or more microRNAs and/or one or more inflammatory markers (e.g. a threshold level or a level present in CSF or on a CD14+CD16+ and CD14+CD16- monocyte (eg, a peripheral or blood-derived monocyte) from a healthy individual.) In these methods, an increase or decrease in the level of one or more microRNAs and/or of one or more inflammatory markers related to the reference level indicates that the individual has an increased or decreased risk of developing a neurodegenerative disorder (e.g., relative to a person who does not demonstrate an increase or decrease in the level of one or more microRNAs and/or of one or more plus inflammatory markers relative to a reference level).
[007] [007] Also provided are methods of predicting the rate of disease progression in an individual who has a neurologic disorder.
[008] [008] Also provided are methods of selecting an individual for the treatment of a neurodegenerative disorder (e.g., amyotrophic lateral sclerosis or multiple sclerosis) that include determining a level of one or more microRNAs and/or of one or more inflammatory markers listed in one or more of Tables 1-21 on a monocyte (e.g., CD14+CD16+ or CD14+CD16- monocyte (e.g., a peripheral or blood-derived monocyte) or in the subject's CSF; comparing the level of one or more microRNAs and/or one or more inflammatory markers to a reference level of one or more microRNAs and/or one or more inflammatory markers (e.g., a threshold level or a n-
[009] [009] Also provided are methods of determining the effectiveness of treating a neurodegenerative disorder (e.g., amyotrophic lateral sclerosis or multiple sclerosis) in an individual, which include determining a level of one or more microRNAs and/or of one or more inflammatory markers listed in one or more of Tables 1-21 on a monocyte (e.g., CD14+CD16+ or CD14+CD16- monocyte (e.g., a peripheral or blood-derived monocyte)) or in the subject's CSF at a first point in time; determining a level of one or more microRNAs and/or one or more inflammatory markers in a monocyte (eg, CD14+CD16+ or CD14+CD16- monocyte (eg, a peripheral or blood-derived monocyte) or in the CSF of the subject at a second time point after administration of at least one dose of a treatment; and comparing the level of one or more microRNAs and/or one or more inflammatory markers at the first time point to the level of a or more microRNAs and/or one or more inflammatory markers at the second time point. In these methods, a return to or approximation to levels in a healthy individual at the second time point (e.g., a decrease or an increase at the level of one or more microRNAs and/or one or more inflammatory markers at the second time point compared to the levels at the first time point, as described herein) indicates that the treatment was effective for the individual (e.g., the treatment was effective with respect to one individual u who has the same neurodegenerative disorder and who receives the same treatment, but does not show a return to or approximation to levels in a healthy individual at the second point in time (e.g., an increase or decrease in the level of one or more microRNAs and /or of one or more inflammatory markers compared to a reference value as described herein) or does not show as significant an increase or decrease in the level of one or more microRNAs and/or of one or more inflammatory markers compared to a reference value as described herein).
[0010] [0010] Methods for selecting an individual for participation in a clinical trial are also provided. These methods include determining a level of one or more microRNAs and/or one or more related inflammatory markers in one or more of Tables 1-21 on a monocyte (eg, CD14+CD16+ or CD14+CD16- monocyte ( for example, a peripheral or blood-derived monocyte) or in the individual's CSF; comparing the level of one or more microRNAs and/or one or more inflammatory markers to a reference level of one or more microRNAs and/or of one or more inflammatory markers (e.g., a threshold level or a level present in the CSF or in a CD14+CD16+ and CD14+CD16- monocyte (e.g., a peripheral or blood-derived monocyte) of an individual healthy); and the selection of an individual who has an increase or decrease in the level of one or more microRNAs and/or of one or more of the inflammatory markers compared to the baseline level for participation in a clinical trial.
[0011] Also provided are methods of treating a neurodegenerative disorder (e.g., amyotrophic lateral sclerosis or multiple sclerosis) in a subject, which include administering to a subject at least one agent (e.g., a nucleic acid inhibitor, e.g. an antagomir) that decreases the expression or activity of one or more of the microRNAs listed in Tables 1,
[0012] [0012] Also provided are methods of treating a neurodegenerative disorder (e.g., ALS, such as sporadic ALS or familial ALS or multiple sclerosis) in a subject, which include administration to a subject who has a disorder. neurodegenerative disease (e.g., ALS, such as sporadic ALS or familial ALS or multiple sclerosis) of at least one inhibitory nucleic acid (e.g., siRNA, an antisense oligonucleotide, an antagomir, and/or a ribozyme) that comprises a sequence that is complementary to a contiguous sequence present in hsa-miR-155 (e.g., a contiguous sequence present in the precursor or mature form of hsa-miR-155).
[0013] [0013] Also provided is an inhibitor nucleic acid comprising a sequence that is complementary to a contiguous sequence, for example, a contiguous sequence of at least 5, 6, 7, 8, 9, 10, 11, 12, 13 , 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides, present in hsa-miR-155, hsa-miR-19b, hsa-miR-106b, hsa- miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa- miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b, hsa-miR-24, hsa-miR- 181a, hsa-miR-103, hsa-miR-532-3p, hsa-
[0014] [0014] Here are provided methods of diagnosing amyotrophic lateral sclerosis (ALS) in an individual, which include: determining a level of one or more microRNAs selected from the group consisting of: hsa-miR-19b, hsa -miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa -miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b, hsa-miR -24, hsa-miR-181a, hsa-miR-103, hsa-miR-155, hsa-miR-532-3p, hsa-miR-518f, hsa-miR-206, hsa-miR-204, hsa-miR -137, hsa-miR-453, hsa-miR-146a, hsa-miR-603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a, hsa-miR-615-5p, hsa-miR -655, hsa-miR-450b-5p, hsa-miR-548b-3p, hsa-miR-584, hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328, hsa -miR-421 and hsa-miR-580 on an individual's CD14+CD16- monocyte; and comparing the level of one or more of the microRNA(s) on an individual's CD14+CD16-monocyte to a reference level of one or more microRNAs; whereby an increase in the level of one or more of hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a , hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa -miR-223, hsa-miR-26a, hsa-miR-26b, hsa-miR-24, hsa-miR-181a, hsa-miR-103, hsa-miR-155 and hsa-miR-532-3p e/ or a decrease in the level of one or more of hsa-miR-518f, hsa-miR-206, hsa-miR-204, hsa-miR-137, hsa-miR-453, hsa-miR-146a, hsa-miR- 603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a, hsa-miR-615-5p, hsa-miR-655, hsa-miR-450b-5p, hsa-miR-548b-3p, hsa-miR-584, hsa-miR-548f, hsa-
[0015] [0015] Methods of diagnosing amyotrophic lateral sclerosis (ALS) in an individual are also provided, which include: determining a level of one or more of hsa-miR-27b, hsa-miR-99b, hsa- miR-146a, hsa-miR-150, hsa-miR-328 and hs-miR-532-3p in cerebrospinal fluid (CSF) in a subject; and comparing the level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p in the CSF of individual at a reference level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p, for whereby an increase in the level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p in the The individual's CSF compared to the reference level indicates that the individual has ALS.
[0016] [0016] Methods of diagnosing familial amyotrophic lateral sclerosis (ALS) in an individual are also provided, which include: determining a level of hsa-miR-27b and a level of one or more of hsa-miR- 99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p in the cerebrospinal fluid (CSF) of a subject; and comparing the level of hsa-miR-27b in the individual's CSF to a reference level of hsa-miR-27b and the level of one or more of hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p in the subject's CSF at a reference level of one or more of hsa-miR-99b, hsa-miR-146a, hsa-miR-150 , hsa-miR-328 and hsa-miR-532-3p; whereby an increase in the level of hsa-miR-27b in the subject's CSF compared to the reference level of hsa-miR-27b and a decrease or no significant change in the level of one or more of hsamiR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in the subject's CSF compared to the reference level of one or more of hsa-miR-99b, hsa-miR- 146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p indicate that the individual has familial ALS.
[0017] [0017] Diagnostic methods of sporadic amyotrophic lateral sclerosis (ALS) in an individual are also provided, which include: determining a level of two or more microRNAs selected from the group consisting of hsa-miR -27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p in the cerebrospinal fluid (CSF) of a subject; and comparing the level of two or more microRNAs in the subject's CSF to a reference level of two or more microRNAs; whereby an increase in the level of two or more microRNAs in the individual's CSF compared to the reference level indicates that the individual has sporadic ALS.
[0018] [0018] Methods for identifying an individual at risk of developing amyotrophic lateral sclerosis (ALS) are also provided, which include: determining a level of one or more microRNAs selected from the group consisting of: hsa-miR -19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR -374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b , hsa-miR-24, hsa-miR-181a, hsa-miR-103, hsa-miR-155, hsa-miR-532-3p, hsa-miR-518f, hsa-miR-206, hsa-miR-204 , hsa-miR-137, hsa-miR-453, hsa-miR-146a, hsa-miR-603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a, hsa-miR-615-5p , hsa-miR-655, hsa-miR-450b-5p, hsa-miR-548b-3p, hsa-miR-584, hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR -328, hsa-miR-421 and hsa-miR-580 on an individual's CD14+CD16-monocyte; and comparing the level of one or more microRNAs in an individual's CD14+CD16-monocyte with a reference level of one or more microRNAs; whereby an increase in the level of one or more of hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a , hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa -miR-223, hsa-miR-26a, hsa-miR-26b, hsa-miR-24, hsa-miR-181a, hsa-miR-103, hsa-miR-155 and hsa-miR-532-3p e/ or a decrease in the level of one or more of hsa-miR-518f, hsa-miR-206, hsa-miR-204, hsa-miR-137, hsa-miR-453, hsa-miR-146a, hsa-miR- 603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a, hsa-miR-615-5p, hsa-miR-655, hsa-miR-450b-5p, hsa-miR-548b-3p, hsa-miR-584, hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328, hsa-miR-421 and hsa-miR-580 on an individual's CD14+CD16-monocyte compared to the reference level indicate that the individual has an increased risk of developing ALS.
[0019] [0019] Methods of identifying an individual at risk of developing amyotrophic lateral sclerosis (ALS) in an individual are also provided, which include: determining a level of one or more of hsa-miR-27b, hsa-miR -99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p in cerebrospinal fluid (CSF) in a subject; and comparing the level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p in the CSF of individual at a reference level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p, for whereby an increase in the level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p in the The individual's CSF compared to the reference level indicates that the individual has an increased risk of developing ALS.
[0020] [0020] Methods of identifying an individual at risk of developing familial amyotrophic lateral sclerosis (ALS) are also provided, which include: determining a level of hsa-miR-27b and a level of one or more of hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p in the cerebrospinal fluid (CSF) of a subject; and comparing the level of hsa-miR-27b in the individual's CSF to a reference level of hsa-miR-27b and the level of one or more of hsa-miR-99b, hsa-miR-146a, hsa- miR-150, hsa-miR-328 and hsa-miR-532-3p in the subject's CSF at a reference level of one or more of hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa -miR-328 and hsa-miR-532-3p, whereby an increase in the level of hsa-miR-27b in the subject's CSF compared to the reference level of hsa-miR-27b and a decrease or no significant change at the level of one or more of hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in the subject's CSF compared to the reference level of a or more of hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p indicate that the individual is at an increased risk of developing familial ALS.
[0021] [0021] Methods of identifying an individual at risk of developing sporadic amyotrophic lateral sclerosis (ALS) are also provided, which include: determining a level of two or more microRNAs selected from the group consisting of hsa-miR -27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p in the cerebrospinal fluid (CSF) of a subject; and comparing the level of two or more microRNAs in the individual's CSF to a reference level of two or more microRNAs, whereby an increase in the level of two or more microRNAs in the individual's CSF compared to the reference level indicates that the individual has an increased risk of developing sporadic ALS.
[0022] [0022] Methods of predicting the rate of disease progression in an individual who has amyotrophic lateral sclerosis (ALS) are also provided, which include: determining a level of one or more microRNAs selected from the group consisting of: hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa- miR-26b, hsa-miR-24, hsa-miR-181a, hsa-miR-103, hsa-miR-155, hsa-miR-532-3p, hsa-miR-518f, hsa-miR-206, hsa- miR-204, hsa-miR-137, hsa-miR-453, hsa-miR-146a, hsa-miR-603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a, hsa-miR- 615-5p, hsa-miR-655, hsa-miR-450b-5p, hsa-miR-548b-3p, hsa-miR-584, hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328, hsa-miR-421, hsa-miR-580, hsa-miR-15b and hsa-miR-19a on a subject's CD14+CD16-monocyte; and comparing the level of one or more microRNAs on an individual's CD14+CD16-monocyte to a reference level of one or more microRNAs; whereby an increase in the level of one or more of hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a , hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa -miR-223, hsa-miR-26a, hsa-miR-26b, hsa-miR-24, hsa-miR-181a, hsa-miR-103, hsa-miR-155, hsa-miR-532-3p, hsa -miR-15b and miR-19a and/or a decrease in the level of one or more of hsa-miR-518f, hsa-miR-206, hsa-miR-204, hsa-miR-137, hsa-miR-453 , hsa-miR-146a, hsa-miR-603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a, hsa-miR-615-5p, hsa-miR-655, hsa-miR-450b -5p, hsa-miR-548b-3p, hsa-miR-584, hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328, hsa-miR-421 and hsa-miR -580 in an individual's CD14+CD16- monocyte compared to the reference level indicates that the individual will have an increased rate of disease progression.
[0023] [0023] Also provided are methods of predicting the rate of disease progression in an individual who has amyotrophic lateral sclerosis (ALS), which include: determining a level of one or more of hsa-miR-27b, hsa -miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p in cerebrospinal fluid (CSF) in a subject; and comparing the level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in the CSF of individual at a reference level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p, for whereby an increase in the level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p in the The individual's CSF compared to the reference level indicates that the individual will have an increased rate of disease progression. In some modalities, an increase in the rate of disease progression is an increased rate of onset of one or more ALS symptoms, an increase in the worsening of one or more ALS symptoms, an increase in the frequency of one or more ALS symptoms, an increase in the duration of one or more symptoms of ALS or a decrease in the individual's longevity.
[0024] [0024] Methods for selecting an individual for the treatment of amyotrophic lateral sclerosis (ALS) are also provided, which include: determining a level of one or more microRNAs selected from the group consisting of: hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa- miR-26b, hsa-miR-24, hsa-miR-181a, hsa-miR-103, hsa-miR-155, hsa-miR-532-3p, hsa-miR-518f, hsa-miR-206, hsa- miR-204, hsa-miR-137, hsa-miR-453, hsa-miR-146a, hsa-miR-603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a, hsa-miR- 615-5p, hsa-miR-655, hsa-miR-450b-5p, hsa-
[0025] [0025] Methods of selecting an individual for the treatment of amyotrophic lateral sclerosis (ALS) are also provided, which include: determining a level of one or more of hsa-miR-27b, hsa-miR -99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p in cerebrospinal fluid (CSF) in a subject; and comparison of the level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p in Subject CSF at a baseline level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532 -3p; and selecting an individual that has an increased level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-
[0026] [0026] Also provided are methods of selecting an individual for the treatment of familial amyotrophic lateral sclerosis (ALS), which include determining a level of hsa-miR-27b and a level of one or more of hsa- miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p in the cerebrospinal fluid (CSF) of a subject; and comparing the level of hsa-miR-27b in the subject's CSF to a reference level of hsa-miR-27b and the level of one or more of hsa-miR-99b, hsa-miR-146a, hsa-miR- 150, hsa-miR-328 and hsa-miR-532-3p in the subject's CSF at a reference level of one or more of hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR -328 and hsa-miR-532-3p; and selecting an individual who has an increase in the level of hsa-miR-27b in the CSF compared to the reference level of hsa-miR-27b and a decrease or no significant change in the level of one or more of hsa- miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in CSF compared to baseline of one or more of hsa-miR-99b, hsa- miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p for the treatment of familial ALS.
[0027] [0027] Methods of selecting an individual for the treatment of sporadic amyotrophic lateral sclerosis (ALS) are also provided, which include: determining a level of two or more microRNAs selected from the group consisting of hsa- miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p in the cerebrospinal fluid (CSF) of a subject; comparing the level of two or more microRNAs in the subject's CSF to a reference level of two or more microRNAs; and the selection of an individual who has an increase in the level of two or more microRNAs in the CSF compared to the reference level.
[0028] [0028] In some embodiments of the methods described herein, the selected individual additionally receives treatment for ALS.
[0029] [0029] Methods for selecting an individual for participation in a clinical trial are also provided, which include: determining a level of one or more microRNAs selected from the group consisting of: hsa-miR-19b , hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b , hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b, hsa -miR-24, hsa-miR-181a, hsa-miR-103, hsa-miR-155, hsa-miR-532-3p, hsa-miR-518f, hsa-miR-206, hsa-miR-204, hsa -miR-137, hsa-miR-453, hsa-miR-146a, hsa-miR-603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a, hsa-miR-615-5p, hsa -miR-655, hsa-miR-450b-5p, hsa-miR-548b-3p, hsa-miR-584, hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328 , hsa-miR-421, hsa-miR-580, hsa-miR-15b and hsa-miR-19a on a subject's CD14+CD16-monocyte; comparing the level of one or more microRNAs in an individual's CD14+CD16-monocyte to a reference level of one or more microRNAs; and selecting an individual who has an increased level of one or more of hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p , hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa -miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b, hsa-miR-24, hsa-miR-181a, hsa-miR-103, hsa-miR-155, hsa-miR -532-3p, hsa-miR-15b and hsa-miR-19a and/or a decrease in the level of one or more of hsa-miR-518f, hsa-miR-206, hs-miR-204, hsa- miR-137, hsa-miR-453, hsa-miR-146a, hsa-miR-603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a, hsa-miR-615-5p, hsa- miR-655, hsa-miR-450b-5p, hsa-miR-548b-3p, hsa-miR-584, hsa-miR-
[0030] [0030] Methods for selecting an individual for participation in a clinical trial are also provided, which include: determining a level of one or more microRNAs selected from the group consisting of hsa-miR-27b, hsa- miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p in the cerebrospinal fluid (CSF) of a subject; comparing the level of one or more microRNAs in the subject's CSF to a reference level of one or more microRNAs; and selecting an individual who has an increased level of one or more microRNAs in the CSF compared to the baseline level for participation in a clinical trial.
[0031] [0031] Methods for determining the effectiveness of treating amyotrophic lateral sclerosis in an individual are also provided, which include: determining a level of one or more microRNAs selected from the group consisting of: hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b, hsa- miR-24, hsa-miR-181a, hsa-miR-103, hsa-miR-155, hsa-miR-532-3p, hsa-miR-518f, hsa-miR-206, hsa-miR-204, hsa- miR-137, hsa-miR-453, hsa-miR-146a, hsa-miR-603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a, hsa-miR-615-5p, hsa- miR-655, hsa-miR-450b-5p, hsa-miR-548b-3p, hsa-miR-584, hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328, hsa-miR-421, hsa-miR-580, hsa-miR-15b and hsa-miR-19a on an individual's CD14+CD16-monocyte at a first time point; determination of a level of one or more microRNAs in an individual's CD14+/CD16-monocyte at a second point
[0032] [0032] Methods of determining the effectiveness of treating amyotrophic lateral sclerosis (ALS) in an individual are also provided, which include: determining a level of one or more of hsa-miR-27b, hsa- miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p in the subject's cerebrospinal fluid at a first time point; determining a level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in the CSF of the subject at a second time point after administration of at least one dose of a treatment; and comparing the level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-
[0033] [0033] In some embodiments of any of the methods described here, the reference level is a threshold level. In some embodiments, the reference level is a level found on a CD14+ CD16- monocyte (eg, a peripheral or blood-derived monocyte) of a control subject. In some modalities, the reference level is a level found in the CSF of a control individual.
[0034] [0034] Some embodiments of the methods described herein further include obtaining a biological sample (e.g., a sample containing blood, plasma, serum, or cerebrospinal fluid) containing a CD14+CD16-monocyte from the subject. In some embodiments, the method further comprises purifying a CD14+CD16-monocyte from the biological sample.
[0035] [0035] Some embodiments of the methods described herein additionally include obtaining a sample that contains the individual's CSF.
[0036] [0036] In some embodiments of any of the methods described herein, the microRNA or one or more microRNAs are a precursor microRNA. In some embodiments of any of the methods described herein, the microRNA or one or more microRNAs is a mature microRNA.
[0037] [0037] Methods of treatment of the sclera are also provided.
[0038] [0038] Also provided are methods of treating amyotrophic lateral sclerosis (ALS) in an individual, which include administering to an individual who has ALS at least one inhibitory nucleic acid that comprises a sequence that is complementary to the ALS. a contiguous sequence present in hsa-miR-155. In some embodiments, at least one inhibitor nucleic acid is an antagomir (for example, an antagomir contains or has a sequence of SEQ ID NO.: 262). In some embodiments, at least one inhibitor nucleic acid is an antisense oligonucleotide. In some embodiments, at least one inhibitor nucleic acid is a ribozyme. In some embodiments, at least one inhibitor nucleic acid is injected into an individual's cerebrospinal fluid (eg, intracranial injection or intrathecal injection). In some embodiments, at least one inhibitory nucleic acid is complexed with one or more cationic polymers and/or cationic lipids. In some embodiments, the inhibitor nucleic acid is delivered using a lentivirus vector.
[0039] [0039] Also provided are methods of using at least one antagomir that comprises a sequence that is complementary to a contiguous sequence present in any one of hs-miR-155, hsa-miR-19b, hsa-miR-106b , hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101 , hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b, hsa-miR-24, hsa -miR-181a, hsa-miR-103, hsa-miR-532-3p, hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, hsa -miR-15b and hsa-miR-19a in the production of a drug for the treatment of amyotrophic lateral sclerosis in an individual. Also provided herein are antagomirs that comprise a sequence that is complementary to a contiguous sequence present in any one of hsa-miR-155, hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa- miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa- miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b, hsa-miR-24, hsa-miR-181a, hsa-miR- 103, hsa-miR-532-3p, hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, hsa-miR-15b and hsa-miR- 19a for use in the treatment of amyotrophic lateral sclerosis in an individual.
[0040] [0040] Also provided are methods of using at least one inhibitory nucleic acid (e.g., an antagomir) that comprises a sequence that is complementary to a contiguous sequence present in hsa-miR-155 in the production of a medicament for the treatment of of amyotrophic lateral sclerosis in an individual. Also provided herein are inhibitory nucleic acids (e.g., antagomirs) that contain a sequence that is complementary to a contiguous sequence present in hsa-miR-155 for use in treating amyotrophic lateral sclerosis in an individual.
[0041] [0041] As used herein, "RNA" refers to a molecule that comprises at least one or more ribonucleotide residues. One
[0042] [0042] A "mature microRNA" (mature miRNA) typically refers to the single-stranded RNA molecules of about 21–23 nucleotides in length, which regulate gene expression. miRNAs are encoded by the genes whose DNA they are transcribed from, but miRNAs are not translated into protein; instead, each primary transcript (pri-miRNA) is processed into a short-stem loop structure (precursor microRNA) before undergoing further processing into a functional mature miRNA. Mature miRNA molecules are partially complementary to one or more messenger RNA (mRNA) molecules, and their primary function is to down-regulate gene expression. As used herein, the term "microRNA" or "miRNA" includes both mature microRNA and precursor microRNA.
[0043] [0043] As used herein, the term "inflammatory marker" refers to any of the proteins or mRNAs listed in Tables 20 and 21. The proteins and mRNAs listed in Tables 20 and 21 have been implicated in a role in inflammation. Methods of detecting the levels or activity of inflammatory markers are known in the state of the art. Additional methods of
[0044] [0044] By the term "reference level" understand a level of control of one of the microRNAs listed in Tables 1-19 or one of the inflammatory markers listed in Tables 20 and 21. A reference level can represent a threshold level of a specific microRNA or an inflammatory marker. A reference level can also be a level of a particular microRNA or an inflammatory marker present in the cerebrospinal fluid or on a monocyte (e.g., CD14+CD16+ or CD14+CD16- monocyte (e.g., a peripheral or derivative monocyte). blood)) of a healthy individual (e.g., an individual who does not have two or more symptoms of a neurodegenerative disorder, an individual who is not diagnosed with a neurodegenerative disorder, and/or an individual who has no family history of neurodegenerative disease).
[0045] [0045] By the term "increase" is meant an observable, detectable or significant increase in a level compared to a reference level or to a level measured at a later or earlier point in time in the same individual.
[0046] [0046] By the term "decrease" is meant an observable, detectable or significant decrease in a level compared to a reference level or to a level measured at a later or earlier point in time in the same individual.
[0047] [0047] By the term "neurodegenerative disorder" is meant a neurological disorder characterized by a progressive loss of neuronal function and structure and neuron death. Non-limiting examples of neurodegenerative disorders include Parkinson's disease (PD), Alzheimer's disease (AD), Huntington's disease (HD), stroke, brain tumors, cardiac ischemia, age-related macular degeneration (AMD), retinitis pigmentosa (RP), amyotrophic lateral sclerosis (ALS,
[0048] [0048] By the term "inhibitory RNA" is meant a nucleic acid molecule that contains a sequence that is complementary to a target nucleic acid (e.g. a target microRNA or target inflammatory marker, e.g. any of the microRNAs listed in the Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18 or any of the inflammatory markers listed in Table 21) that mediate a decrease in target nucleic acid level or activity (eg. (eg, activity on CD14+CD16+ and CD14+CD16- monocyte). Non-limiting examples of inhibitory RNAs include interfering RNA, shRNA, siRNA, ribozymes, antagomirs, and antisense oligonucleotides. Methods of producing inhibitory RNAs are described herein. Additional methods of producing inhibitory RNAs are known in the art.
[0049] [0049] As used herein, an "interfering RNA" refers to any single-stranded or double-stranded RNA sequence that can – directly or indirectly (i.e. upon conversion) – inhibit or down-regulate gene expression. by mediating RNA interference. Interfering RNA includes, but is not limited to, small interfering RNA ("siRNA") and small hairpin RNA ("shRNA"). "RNA interference" refers to the selective degradation of a sequence-matched messenger RNA transcript.
[0050] [0050] As used herein, "an shRNA" (small hairpin RNA) refers to an RNA molecule comprising an antisense region, a loop portion, and a sense region, wherein the sense region has complementary nucleotides that base pair with the antisense region to form a stem with
[0051] [0051] A "small interfering RNA" or "siRNA" as used herein refers to any small RNA molecule that can inhibit or down-regulate gene expression by RNA interference by mediating in a specific manner the sequence. Small RNA can be, for example, about 18 to 21 nucleotides in length.
[0052] [0052] As used herein, an "antagomir" refers to a small synthetic RNA that has complementarity to a specific target microRNA, optionally with mismatch at the cleavage site or one or more base modifications to inhibit cleavage.
[0053] [0053] As used herein, the phrase "post-transcriptional processing" refers to the processing of mRNA that occurs after transcription and is mediated, for example, by the enzyme Dicer and/or Drosha.
[0054] [0054] By the phrase "risk of developing the disease" I mean the relative probability that an individual will develop a neurodegenerative disorder in the future compared to a control individual or population (e.g., an individual or a healthy population). Here, methods of determining an individual's risk of developing a neurodegenerative disease in the future are provided, which include determining the level of one or more of the microRNAs listed in Tables 1-19 and/or one or more of the related inflammatory markers. in Tables 20-21.
[0055] [0055] By the phrase "rate of disease progression" is meant one or more of the rate of onset of symptoms of a neurodegenerative disorder in an individual, the rate of increasing intensity (worsening) of symptoms of a neurodegenerative disorder in an individual , the fre-
[0056] [0056] By the term "purification" I mean a partial isolation of a substance from its natural environment (eg, partial removal of contaminating biomolecules or cells). For example, a monocyte (e.g. CD14+CD16+ or CD14+CD16- monocyte) can be purified from other cell types present in a peripheral blood sample (e.g. using cell sorting). fluorescence-assisted squid).
[0057] [0057] The term "treatment" includes reducing the number of symptoms or reducing the severity, duration or frequency of one or more disease symptoms (eg, a neurodegenerative disease) in an individual. The term "treatment" may also include reducing the risk of developing a neurodegenerative disorder in an individual, delaying the onset of symptoms of a neurodegenerative disorder in an individual, or increasing the longevity of an individual who has a neurodegenerative disorder. neurodegenerative.
[0058] [0058] By the term "cationic polymer" is meant a polymeric material that is positively charged at a physiological pH (e.g., a pH of about 6.5 to 8.0) that can condense nucleic acids.
[0059] [0059] By the term "cationic lipid" is meant a lipid that has at least one positive charge at a physiological pH (e.g., a pH of about 6.5 to 8.0) that can form a complex with an acid. nucleic. Non-limiting examples of cationic lipids include 1,2-dioleyl-3-trimethylammonium propone (DOTAP), N-methyl-4-(dioleyl)methylpyridinium and 3-[N-(N',N'dimethylaminoethane)-carbamoyl] co- esterol. Additional examples of cationic lipids are known in the art and commercially available (e.g. Lipofectamine™ 2000; Life Technologies Corporation, Carlsbad, Ca).
[0060] [0060] Other definitions appear in context throughout this description. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as generally understood by a person skilled in the art to which the present invention belongs. Methods and materials are described herein for use in the present invention; other appropriate methods and materials known in the art may also be used. Materials, methods and examples are illustrative only and are not intended to be limiting. All publications, patent applications, patents, sequences, database entries and other references mentioned herein are hereby incorporated by reference in their entirety. In case of conflict, this descriptive report, including its definitions, will prevail.
[0061] [0061] Other features and advantages of the invention will become apparent from the following detailed description and figures, and from the claims. Brief Description of Drawings
[0062] [0062] Figure 1A is a volcano diagram of significant microRNAs.
[0063] [0063] Figure 1B is a Venn diagram of significantly dysregulated microRNAs in CD39+ microglia in SODG93A mice compared to expression of microRNAs in CD39+ microglia of non-transgenic "litermates" through all stages of the disease. The numbers represent significantly dysregulated microRNAs at each stage of the disease.
[0064] [0064] Figure 1C is a summary of significantly dysregulated microRNAs in CD39+ microglia in SODG93A mice compared to expression of microRNAs in CD39+ microglia of non-transgenic "litermates". These data were validated in singleplex TaqMan PCR.
[0065] [0065] Figure 2A is a volcano diagram of significantly dysregulated microRNAs in Ly6CHi monocytes in SODG93A mice compared to expression of microRNAs in Ly6CHi monocytes of non-transgenic "litermates" at a pre- -symptomatic (60 days) (Pre-symptomatic), at the onset of symptoms (Onset) and in the final stage of the disease (Final Stage). The X axis represents the changes in expression (change in log2 magnification based on ddCT values) and the Y axis shows the statistical significance of the change in log probabilities.
[0066] [0066] Figure 2B is a Venn diagram of significantly dysregulated microRNAs in Ly6CHi monocytes in mice
[0067] [0067] Figure 2C is a summary of significantly dysregulated microRNAs in Ly6CHi monocytes in SODG93A mice compared to microRNA expression in Ly6CHi monocytes from non-transgenic litermates. These data were validated in singleplex TaqMan PCR.
[0068] [0068] Figure 3A is a volcano diagram of significantly dysregulated microRNAs in Ly6CLow monocytes in SODG93A mice compared to microRNA expression in Ly6CLow monocytes of non-transgenic litermates (at one point in time). pre-symptomatic period of 60 days), at the onset of symptoms (Onset) and at the final stage of the disease (Final Stage). The X axis represents the changes in expression (change in log2 magnification based on ddCT values) and the Y axis shows the statistical significance of the change in log probabilities.
[0069] [0069] Figure 3B is a Venn diagram of significantly dysregulated microRNAs in Ly6CLow monocytes in SODG93A mice compared to expression of microRNAs in Ly6CLow monocytes of non-transgenic litermates through all stages of development. disease. The numbers represent significantly dysregulated microRNAs at each stage of the disease.
[0070] [0070] Figure 3C is a summary of significantly dysregulated microRNAs in Ly6CLow monocytes in SODG93A mice compared to microRNA expression in Ly6CLow monocytes from non-transgenic litermates. These data were validated in singleplex TaqMan PCR.
[0071] [0071] Figure 4 is a graph and table showing the results of the analysis of the Ingenuity pathway of the 32 deregulated microRNAs in Ly6CHi monocytes (compared to non-transgenic literacy controls) through all stages disease in SOD1 mice. The graph shows the patterns seen in skeletal disorders, muscle disorders, and myopathic disorders.
[0072] [0072] Figure 5 is a heat map showing the profiling of blood-derived CD14+CD16- monocytes of the nCounter expression for 664 microRNAs in sporadic ALS (8 subjects) and relapsing-remitting multiple sclerosis (8 subjects). ) compared to the expression of microRNAs in CD14+CD16- monocytes of healthy controls (8 individuals). The heat map shows the results of analysis of variance (ANOVA) using Dunnett's post hoc test (P<0.01). Up-regulated or down-regulated microRNAs on CD14+CD16-monocytes from individuals with ALS (compared to the expression of these microRNAs on CD14+CD16- monocytes from healthy controls) are indicated. Each row of the heat map represents an individual gene and each column an individual.
[0073] [0073] Figure 6 is a heat map showing the profiling of blood-derived CD14+CD16- monocytes of the nCounter expression for 664 microRNAs in sporadic ALS (8 subjects) and relapsing-remitting multiple sclerosis (8 subjects). ) compared to the expression of these microRNAs in CD14+CD16- monocytes from healthy controls (8 individuals). The heat map shows the results of the post hoc ANOVA test using Dunnett (P<0.01). Up-regulated or down-regulated microRNAs on CD14+CD16- monocytes of individuals with MS (compared to the expression of microRNAs on CD14+CD16- monocytes of healthy controls) are indicated. Each row of the heat map represents an individual gene and each column an individual.
[0074] [0074] Figure 7A is a Venn diagram of deregulated (up-regulated or down-regulated) unique or similar microRNAs in CD14+CD16-monocytes from ALS and MS individuals compared to the expression of microRNAs in CD14+ CD16- monocytes from healthy controls.
[0075] [0075] Figure 7B is a volcano diagram showing significantly dysregulated microRNAs on CD14+CD16- monocytes from ALS subjects compared to the expression of microRNAs on CD14+CD16- monocytes from healthy controls.
[0076] [0076] Figure 7C is a volcano diagram showing significantly dysregulated microRNAs in CD14+CD16- monocytes from MS subjects compared to microRNAs expression in CD14+CD16- monocytes from healthy controls.
[0077] [0077] Figure 8 is a summary of significantly dysregulated microRNAs in CD14+CD16-monocytes from ALS and MS subjects compared to the expression of microRNAs in CD14+CD16-monocytes from healthy controls. The bars show that the relative expression of deregulated microRNAs on CD14+CD16- monocytes of individuals with ALS and MS compared to the expression of microRNAs on CD14+CD16- monocytes of healthy controls.
[0078] [0078] Figure 9 is a set of six graphs showing the expression of six different microRNAs on CD14+CD16-monocytes from healthy subjects (8 subjects) and from subjects who have ALS (11 subjects) (as determined by time-lapse PCR). real). A two-tile Mann-Whitney t-test was used to calculate P values (*, P<0.05; **, P<0.01; ***, P<0.001).
[0079] [0079] Figure 10A are two graphs that show the clinical score (eclassification of forced vital capacity (FVC) and Functional Rating Range (FRS)) of eight different patients with ALS. A comparison of microRNA expression in CD14+CD16-mo-
[0080] [0080] Figure 10B is a list of the eight different patients with ALS depicted in Figures 10A and 10C.
[0081] [0081] Figure 10C is twenty graphs showing the expression of twenty up-regulated microRNAs on CD14+CD16-monocytes from individuals with sporadic ALS (8 individuals), healthy individuals, and individuals who have MS (determined using the real-time PCR). A two-tile Mann-Whitney T test was used to calculate the P values.
[0082] [0082] Figure 11 is four graphs showing real-time PCR analysis of the expression of four up-regulated microRNAs in CD14+CD16- monocytes from individuals with sporadic ALS (n=11) compared to controls healthy (n=8) and to individuals with MS (n=8). The data shown were generated using one-way ANOVA and Dunett's multiple comparison test (***, p<0.001).
[0083] [0083] Figure 12A are two graphs that show the clinical score (eclassification of forced vital capacity (FVC) and the Functional Rating Range (FRS)) of eight different patients with ALS. A comparison of microRNA expression on CD14+CD16- monocytes from these eight patients with microRNA expression on CD14+CD16- monocytes of healthy controls and individuals with MS is shown in Figure 10C.
[0084] [0084] Figure 12B is a list of the eight different patients with ALS depicted in Figures 12A and 12C.
[0085] [0085] Figure 12C is twenty graphs showing the expression of twenty down-regulated microRNAs on CD14+CD16-monocytes of individuals with sporadic ALS compared to healthy individuals and individuals who have relapsing-remitting MS (MS-RR) ( determined using real-time PCR). A two-tile Mann-Whitney t-test was used to calculate P values (*, P<0.05; **, P<0.01; ***, P<0.001).
[0086] [0086] Figure 13 is eight graphs showing the expression of eight up-regulated microRNAs on CD14+CD16- monocytes of sporadic ALS and MS-RR compared to healthy individuals, (8 individuals in each group) (determined using real-time PCR). The data shown were generated using one-way ANOVA and Dunett's multiple comparison test (**, P<0.01; ***, p<0.001).
[0087] [0087] Figure 14 is five different graphs showing the expression of five up-regulated microRNAs on the CD14+CD16- monocytes of subjects with MS-RR compared to healthy subjects and subjects who have ALS (8 subjects) ( determined using real-time PCR). A two-tile Mann-Whitney t-test was used to calculate P values (*, P<0.05; **, P<0.01; ***, P<0.001).
[0088] [0088] Figure 15 are five graphs showing the expression of five down-regulated microRNAs on CD14+CD16-monocytes from subjects with MS-RR compared to healthy subjects and subjects who have sporadic ALS (determined by real-time PCR ). A two-tile Mann-Whitney t-test was used to calculate P values (*, P<0.05).
[0089] [0089] Figure 16 is six graphs showing the expression of six up-regulated microRNAs in the cerebrospinal fluid (CSF) of healthy subjects, subjects with familial ALS (n=5) and subjects with sporadic ALS (n= 10). Data were analyzed using ANOVA with Bonfferoni's multiple comparison test. *, p<0.05; **, p<0.01; and ***, p<0.001.
[0090] [0090] Figure 17 is a heat map showing the nCounter expression profiles of 179 inflammation-related genes ("inflammatory marker genes") in the CD14+CD16-monocytes of individuals with ALS (n=8) and of individuals with MS (n=11) compared to the levels of these inflammatory marker genes in CD14+CD16- monocytes of healthy controls (n=10). Data analysis was performed using ANOVA with Dunnett's post hoc test (p<0.01). Each row of the heat map represents an individual gene and each column represents an individual.
[0091] [0091] Figure 18A is two volcano diagrams showing significantly dysregulated inflammatory marker genes on CD14+CD16-monocytes of ALS subjects (left graph) and MS subjects (right graph) compared to the level of inflammatory marker genes on CD14+CD16- monocytes from healthy controls.
[0092] [0092] Figure 18B is a summary of inflammatory marker genes significantly dysregulated in CD14+CD16- monocytes from ALS and MS subjects compared to the level of inflammatory marker genes in CD14+CD16- monocytes from healthy controls. dible. The bars show the relative expression of dysregulated inflammatory marker genes on CD14+CD16- monocytes from ALS and MS subjects compared to the expression of these genes on CD14+CD16- monocytes from healthy controls.
[0093] [0093] Figure 19 is eight graphs that show the expression of eight different microRNAs in CD14+CD16+ monocytes of healthy controls (n=8) and individuals with ALS (n=11) (determined using real-time PCR ). Data were analyzed using the Mann-Whitney two-tile T test (*, P<0.05).
[0094] [0094] Figure 20A is a heat map showing the nCounter expression profiles of microRNAs in CD14+CD16+ monocytes of individuals with ALS (n=8) and individuals with MS (n=8) in comparison to their expression microRNAs on CD14+CD16+ monocytes from healthy controls (n=8). Data analysis was performed using ANOVA with Dunnett's post hoc test (p<0.01). Each row of the heat map represents an individual gene and each column represents an individual. Up-regulated or down-regulated microRNAs on CD14+CD16+ monocytes from individuals with ALS relative to CD14+CD16+ monocytes from healthy individuals are indicated.
[0095] [0095] Figure 20B is a heat map showing the nCounter expression profiles of microRNAs in CD14+CD16+ monocytes of individuals with ALS (n=8) and individuals with MS (n=8) compared to the expression of microRNAs on CD14+CD16+ monocytes from healthy controls (n=8). Data analysis was performed using ANOVA with Dunnett's post hoc test (p<0.01). Each row of the heat map represents an individual gene and each column represents an individual. Up-regulated or down-regulated microRNAs on CD14+CD16+ monocytes of individuals with MS relative to the expression of microRNAs on CD14+CD16+ monocytes of healthy individuals are indicated.
[0096] [0096] Figure 20C is a summary of significantly dysregulated microRNAs in CD14+CD16+ monocytes in ALS and MS subjects compared to the expression of microRNAs in CD14+CD16+ monocytes in healthy controls. The bars show the relative expression of dysregulated microRNAs on CD14+CD16+ monocytes from individuals with ALS and MS compared to the expression of microRNAs on CD14+CD16+ monocytes in healthy controls.
[0097] [0097] Figure 21A are nCounter expression profiles of 179 inflammatory marker genes in Ly6CHi monocyte subsets derived from the spleen of SOD1G93A mice compared to the same non-transgenic cell litermates (Tg) in the pre-symptomatic period. (60d), early (defined by body weight loss) and late-stage disease. An ANOVA heat map with the results of Dunett's post hoc test (P<0.01) showing genes with transcription levels altered at least twice is shown. Each row of the heat map represents an individual gene and each column an individual group in biological triplicates (n=3 arrays for each group of a group of 4-5 mice at each time point). The non-transgenic replicas at each stage of the disease were broken down and the genes were hierarchically clustered. The level of gene expression was normalized against the geometric mean of six "housekeeping" genes (CLTC, GAPDH, GUSB, HPRT1, PGK1 and TUBB5).
[0098] [0098] Figure 21B is nCounter expression profile data showing the inflammatory marker genes that are significantly down-regulated in subsets of Ly6CHi monocytes derived from the spleen of SOD1G93A mice compared to the same cells in the "litermates" ( Tg) non-transgenic in the pre-symptomatic (60d), early (defined by body weight loss) and late stage of the disease.
[0099] [0099] Figure 21C is a list of the main biological networks activated in spleen-derived Ly6CHi monocytes one month before disease onset in SOD1G93A mice.
[00100] [00100] Figure 21D shows the nCounter expression profile data of up-regulated genes in CD39+ microglia derived from the spinal cord of SOD1G93A mice compared to the same cells of non-transgenic "litermates".
[00101] [00101] Figure 21E shows nCounter expression profile data of down-regulated genes in CD39+-derived microglia.
[00102] [00102] Figure 21F is a list of major biological pathways activated in CD39+ microglia derived from the spinal cord of SOD1 mice at the onset of disease
[00103] [00103] Figure 21G is a comparative analysis of significantly up-regulated genes in CD39+ microglia from the spinal cord of SOD1 mice at baseline versus CD39+ microglia isolated from the brain of the same SOD1 mice.
[00104] [00104] Figure 22A is a profile of nCounter expression of 184 inflammation-related genes in CD14+CD16-monocytes in the blood of individuals with sporadic ALS (n=11) and MS (n=8) in comparison to healthy controls (n=10).
[00105] [00105] Figure 22B is a graph showing the time differences in the expression of significantly dysregulated genes in subjects with sporadic ALS and MS compared to healthy controls. The level of gene expression was normalized against the geometric mean of 6 genes from the internal reference housework (CLTC, GAPDH, GUSB, PGK1 and TUBB5).
[00106] [00106] Figure 22C is a graph showing the principal component analysis (PCA) of dysregulated genes identified between individuals with sporadic ALS and individuals with MS with spatial gene distribution.
[00107] [00107] Figure 23A is a profile of nCounter expression of CD14+ CD16- monocytes sorted from blood for 511 immune genes and 184 inflammation-related genes in sporadic ALS (10 subjects) and familial SOD1 ALS (4 subjects) in compared to healthy controls (10 subjects). The profile (heat map) is an unsupervised hierarchical cluster (Pearson correlation) that shows significantly dysregulated genes (non-pa-
[00108] [00108] Figure 23B is a graph showing the time differences of significantly dysregulated genes in CD14+CD16-sorted monocytes from sporadic ALC blood and from individuals with familial ALS versus healthy controls. The level of gene expression was normalized against the geometric mean of 15 genes from the internal reference housework (ABCF1, ALAS1, EEF1G, G6PD, GAPDH, GUSB, HPRT1, OAZ1, POLR1B, POLR2A, PPIA, R-PL19, DSHA, TBP and TUBB).
[00109] [00109] Figure 23C is a graph of PCA analysis of dysregulated genes identified in CD14+CD16-sorted blood monocytes of sporadic ALS and individuals with familial ALS versus healthy controls with spatial gene distribution.
[00110] [00110] Figure 24 is a set of eight graphs showing the validation of real-time PCR of eight genes that were the most significantly dysregulated in CD14+CD16- sorted monocytes from the blood of individuals with familial ALS and/or or sporadic compared to CD14+CD16-sorted monocytes from the blood of healthy controls. The relative expression in sporadic ALS and in familial ALS versus healthy controls was calculated using the comparative Ct (2-Ct) method. The level of gene expression was normalized against the geometric mean of three genes from household chores (GAPDH, TUBB and GRB2). Polymerase chain reactions were performed in duplicate for each individual. Graphs represent one-sense analysis of variance (ANOVA) and Dunett's multiple comparison test of significantly dysregulated genes in individuals with ALS.
[00111] [00111] Figure 25 is a graph of Ingenuity target filter analysis showing the top ten miRNA-mRNA interactions on CD14+CD16-monocytes in the blood of individuals with ALS based on the significantly dysregulated miRNAs and mRNAs identified in CD14+CD16 - blood monocytes from individuals with ALS.
[00112] [00112] Figure 26 is a table of results of target analysis between microRNA-mRNA performed on data collected from CD14+CD16-monocytes from the blood of individuals with ALS (IPA; Ingenuity). The results show 32 miRNAs that target 27 mRNAs.
[00113] [00113] Figure 27 is a graph depicting the interactions between microRNA-mRNA on CD14+CD16-sorted blood monocytes in ALS. The graph depicts the results for significantly dysregulated miRNA and immunorelated genes in CD14+CD16-sorted monocytes from the blood of individuals with ALS. A total of 32 miRNAs targeting 27 mRNAs are shown.
[00114] [00114] Figure 28 are two graphs showing the distribution of possible random interactions between 1000 random unregulated miRNA-mRNA pairs compared to putative miRNA-mRNA pairs observed in 41 highly expressed unregulated miRNAs and 47 dysregulated genes observed in splenic Lys6CHi monocytes of SOD1 mice (Figure 29A) and 64 highly expressed unregulated miRNAs and 59 dysregulated genes observed in CD14+CD16- peripheral blood monocytes of ALS subjects (Figure 28B) (Targetscan 4.1).
[00115] [00115] Figure 29 is a table showing the 20 higher transcription factors and target genes dysregulated in the CD14+CD16- sorted monocytes from the blood of individuals with ALS (determined using GeneGo pathway analysis) and a graph showing specificity protein transcription factor-1 (SP1) and its genes targeted on CD14+CD16- sorted blood monocytes in individuals with ALS.
[00116] [00116] Figure 30 is a graph of Kaplan-Meir analysis of probability of survival for SOD1/miR-155-/- and SOD1/miR-155+/- mice. Comparison of the Mantel-Cox F test between groups of SOD1/miR-155-/- mice versus SOD1/miR-155+/- (P<0.0001).
[00117] [00117] Figure 31 is a graph of the time-to-event analysis for the neurological onset of the disease (neurological severity score 2). Disease onset was significantly delayed (P<0.0001) in SOD1/miR-155-/- mice compared to SOD1/miR-155+/- mice.
[00118] [00118] Figure 32 is a graph of the spin bar performance of SOD1/miR-155-/- and SOD1/miR-155+/- mice as a function of age. **P<0.01; ***P<0.001; by Fisher's factorial and post hoc LSD ANOVA test.
[00119] [00119] Figure 33 is a graph of the weight loss of SOD1/miR-155-/- and SOD1/miR-155+/- mice. Statistical analysis was performed using two-way ANOVA, Bonferri's post hoc test. ***P<0.001.
[00120] [00120] Figure 34 is a set of two graphs showing the duration of an early stage of the disease (from onset to a 5% weight loss) (graph on the left) and the duration of a later stage of the disease (from 5% weight loss to final stage) for SOD1/miR-155-/- and SOD1/miR-155+/- mice.
[00121] [00121] Figure 35A shows data from fluorescence activated cell sorting (FACS) analysis of spinal cord-derived mononuclear cells stained with 4D4 (resident microglia) and CD11b (myeloid cells) in wild-type mice, SOD1/miR155+/ +, SOD1/miR155-/+ and SOD1/miR155-/-.
[00122] [00122] Figure 35B shows the absolute number of microglia (4D4 positive) and monocyte cells (CD11b positive) per spinal cord in wild type mice, SOD1/miR155+/+, SOD1/miR155-/+ and SOD1/miR155 -/-.
[00123] [00123] Figure 36 is a set of four heat maps showing the expression of inflammation-related genes in spinal cord microglia and splenic Ly6CHi monocytes in wild-type mice, SOD1/miR155-/+ and SOD1/ miR155-/-. The heat maps labeled (a) are of animals in the final stage. (Note that SOD1/miR155-/- mice are still viable and breeding at the end of the study, with SOD1/miR-/+ mice experiencing an onset of symptoms (end stage)). All mice are a base of C57/BI6-SOD1 males. The labeled heat maps (b) indicate the genes significantly affected by miR155 in SOD1 mice.
[00124] [00124] Figure 37 is the nCounter expression profile data showing the expression of various mouse microRNAs in Ly6CHi monocyte subsets derived from the spleen of wild-type mice, SOD1/miR155-/+ and SOD1/miR155- /-.
[00125] [00125] Figure 38 is a heat map and bar graph showing the profiling of nCounter expression of CD14+ CD16- blood-derived monocytes for microRNAs in sporadic ALS (8 subjects) and relapsing-remitting multiple sclerosis (8 individuals) compared to the expression of microRNAs on CD14+CD16-monocytes from healthy controls (8 individuals). The heat map shows the results of analysis of variance (ANOVA) using Dunnett's post hoc test (P<0.01). Up-regulated or down-regulated microRNAs on CD14+CD16-monocytes from individuals with ALS (compared to the expression of these microRNAs on CD14+CD16-monocytes from healthy controls) are indicated. Each row of the heat map represents an individual gene and
[00126] [00126] The invention is based, at least in part, on the finding that specific microRNAs and inflammatory markers are dysregulated on CD14+CD16-monocytes and/or CD14+CD16+ monocytes (e.g., peripheral monocytes or blood derivatives) of patients who have a neurodegenerative disease, and that specific microRNAs are present at increased or decreased levels in the cerebrospinal fluid of patients who have a neurodegenerative disorder (eg, ALS (eg, sporadic and familial ALS) and MS) compared to healthy subjects. The invention is also based on the finding that hsa-miR-155 plays a significant role in disease development in a mouse model of ALS. In view of this verification, methods of diagnosing a neurodegenerative disorder, identifying an individual at risk (eg, at increased risk or decreased risk) of developing a neurodegenerative disorder, predicting the rate of disease progression in a individual who has a neurodegenerative disorder, selection of an individual for treatment of a neurodegenerative disorder, selection of a treatment for an individual who has a neurodegenerative disorder, determination of the effectiveness of treatment for a neurodegenerative disorder, and selection of an individual for participation in a clinical trial are provided herein. These methods include measuring a level of one or more (eg, at least 2, 3, 4, 5, 6, 7, 8, 9, or 10) microRNAs listed in one or more of Tables 1-19 and /or one or more inflammatory markers listed in Tables 20-21.
[00127] [00127] Also provided are methods of treating a neurodegenerative disorder (e.g., ALS or MS) that include administering to a subject an agent (e.g., a nucleic acid) that decreases the level or activity of one or more more of the microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18 (eg, hsa-miR-155), and/or increases the level or activity of one or more more of the microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, or 19. Also provided are methods of treating a neurological disorder (eg, ALS or MS) that include administering to a subject of an agent (e.g. a nucleic acid) that decreases the expression (e.g. protein or mRNA) and/or activity of one or more of the inflammatory markers listed in Table 21 and/or increases expression (e.g. , protein or mRNA) and/or the activity of one or more of the genes listed in Table 20.
[00128] [00128] Also provided are nucleic acids that contain a sequence complementary to a sequence present in any of the microRNAs listed in Tables 1-19 or to a sequence present in an mRNA that encodes any of the genes listed in Tables 20 and 21 (eg primer or probe). Also provided are nucleic acids that contain a sequence that is complementary to a sequence present in any of the microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18 (the target microRNA ) or a sequence present in an mRNA encoded by any of the genes listed in Table 21 (the target mRNA), which decreases the expression or activity of the target microRNA or target mRNA (e.g. an inhibitory RNA, e.g. any one of the inhibitor nucleic acids described herein). Also provided are compositions that contain a nucleic acid that includes the sequence of any of the microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, and 19 (the target microRNA) or a sequence present in a mRNA encoded by any of the genes listed in Table 20 (the target mRNA), which increases the expression or activity of the target microRNA or target mRNA. Also included are compositions that contain at least one antibody that specifically binds to any of the proteins listed in Table 20 and Table 21. Also included are compositions that contain at least one protein listed in Table 20. and in Table 21. Kits that contain one or more of the above nucleic acids, proteins or antibodies (in any combination) are also provided. Neurodegenerative Disorders
[00129] [00129] Neurodegenerative disorders are a class of neurological diseases that are characterized by the progressive loss of structure and function of neurons and neuronal cell death. Inflammation has been implicated for its role in several neurodegenerative disorders. The progressive loss of motor and sensory neurons and the mind's ability to relate sensory information to an external object is affected in different types of neurodegenerative disorders. Nonlimiting examples of neurodegenerative disorders include Parkinson's disease, Alzheimer's disease, Huntington's disease, amyotrophic lateral sclerosis (ALS, eg familial ALS and sporadic ALS) and multiple sclerosis (MS).
[00130] [00130] A healthcare professional may diagnose an individual as having a neurodegenerative disorder by evaluating one or more symptoms of a neurodegenerative disorder in the individual. Non-limiting symptoms of a neurodegenerative disorder in an individual include difficulty lifting the forefoot and toes; weakness in the arms, legs, feet, or ankles; weakness or clumsiness with the hands; ill-articulated speech; difficulty swallowing; cramps; involuntary contraction in arms, shoulders and tongue; difficulty chewing; difficulty breathing; muscle paralysis; partial or complete loss of vision; double vision; tingling or pain in parts of the body; electric shock sensations that occur with head movements; tremor; unsteady walk; fatigue; vertigo; memory loss; disorientation; misinterpretation of spatial relationships; difficulty reading or writing; difficulty concentrating and thinking; difficulty making judgments and decisions; difficulty planning and executing family tasks; depression; anxiety; social withdrawal; mood swings; irritability; aggressiveness; changes in sleep habits; sleep-walking; insanity; loss of automatic movements; impaired posture and balance; stiff muscles; bradykinesia; slow or abnormal eye movements; jerking movements or involuntary contortions (chorea); involuntary and sustained contraction of muscles (dystonia); lack of flexibility; lack of impulse control; and changes in appetite. A health care professional may also base their diagnosis, in part, on the family history of the individual with a neurodegenerative disorder. A healthcare professional may diagnose an individual as having a neurodegenerative disorder when an individual attends a healthcare facility (eg, a clinic or hospital). In some cases, a health care professional may diagnose an individual as having a neurodegenerative disorder when the individual is admitted to an assisted care facility. Typically, a physician diagnoses a neurodegenerative disorder in an individual after presenting with one or more symptoms.
[00131] [00131] Provided herein are additional methods for diagnosing a neurodegenerative disorder in an individual (e.g., an individual who exhibits one or more symptoms of a neurodegenerative disorder, or an individual who does not exhibit a symptom of a neurodegenerative disorder (e.g., , an undiagnosed and/or asymptomatic individual).
[00132] [00132] Any combination of one or more of the markers described herein may be used in any of the methods described herein, e.g. used in the methods of diagnosing a neurodegenerative disorder in an individual, identifying an individual at risk (e.g. (e.g., at increased or decreased risk) of developing a neurodegenerative disorder, predicting the rate of disease progression in an individual who has a neurodegenerative disorder, selecting an individual for treatment of a neurodegenerative disorder, determining the effectiveness of the treating an individual who has a neurodegenerative disorder or selecting an individual for participation in a clinical trial.
[00133] [00133] Increased MicroRNA markers on monocytes (CD14+CD16- or CD14+CD16+ monocytes) or CSF in individuals who have a neurodegenerative disorder relative to healthy controls (CD14+CD16- or CD14+CD16+ monocytes, or CSF in healthy controls) are listed in Table 1. Table 1. List of microRNAs increased in CD14+CD16- monocytes, CD14+CD16- monocytes or in the CSF of patients who have neurodegenerative disorders compared to healthy controls MiRNA LMiRNA sequence MiRNA sequence of mature precursor hsa-miR-19b gugcaaauccaugcaaaacuga CACUGUUCUAUGGUUAGUUUUGCAGGUU (SEQ ID NO.: 1) UGCAUCCAGCUGUGUGAUAUUCUGCUGU ugugcaaauccaugcaaaacu- GCAAAUCCAUGCAAAACUGACUGUGGUA- ga (SEQ ID NO.: 2) GUG (SEQ ID NO.: 3) ACAUUGCUACUUACAAUUAGUUUUGCAGG
[00134] [00134] Decreased MicroRNA markers on CD14+CD16- or CD14+CD16+ monocytes in individuals who have a neurodegenerative disorder relative to healthy controls (CD14+CD16- or CD14+CD16+ monocytes in healthy controls) are listed in the Table 2. Table 2. List of decreased microRNAs on CD14+CD16- or CD14+CD16+ monocytes of individuals who have a neurodegenerative disease compared to healthy controls miRNA Sequence of mature MiRNA Precursor miRNA sequence hsa-miR- gaaagcgcuucucuuagagg UCUCAUGCUGUGACCCUCUAGAGGGAA 518f (SEQ ID NO .: 150) GCACUUUCUCUUGUCUAAAAGAAAAGAA AGCGCUUCUCUUUAGAGGAUUACU- CUUUGAGA (SEQ ID NO .: 151) hsa-miR-206 uggaauguaaggaagugugugg UGCUUCCCGAGGCCACAUGCUUCUUUA (SEQ ID NO .: 152) UAUCCCCAUAUGGAUUACUUUGCUAUGG AAUGUAAGGAAGUGUGUGGUUUCGG- CAAGUG (SEQ ID NO .: 153) hsa-miR - uucccuuugucauccuaugccu GGCUACAGUCUUUCUUCAUGUGACUCG miRNA Mature MiRNA sequence Precursor miRNA sequence 204 (SEQ ID NO.: 154) UGGACUUCCCUUUGUCAUCCUAUGC ASS
[00135] [00135] Increased MicroRNA markers on monocytes (CD14+CD16- or CD14+CD16+ monocytes) or CSF in individuals who have ALS relative to healthy controls (CD14+CD16- or CD14+CD16+ monocytes, or CSF in controls healthy) are listed in Table 3. Table 3. List of microRNAs increased in CD14+CD16- or CD14+CD16+ monocytes or in CSF in subjects who have ALS relative to healthy controls hsa-miR-19b hsa-miR-26b hsa-let-7a hsa-miR-106b hsa-miR-24 hsa-miR-574-3p hsa-miR-30b hsa-miR-181a hsa-miR-19a hsa-miR-21 hsa-miR-103 hsa-let -7f hsa-miR-142-5p hsa-miR-155 hsa-miR-140-5p hsa-miR-27a hsa-miR-532-3p hsa-miR-30a hsa-miR-16 hsa-miR-1260 hsa- miR-190 hsa-miR-374a hsa-miR-423 hsa-miR-500 hsa-miR-374b hsa-miR-361-5p hsa-let-7i hsa-miR-101 hsa-miR-93 hsa-miR-23a hsa-miR-340 hsa-miR-221 hsa-miR-142-3p hsa-miR-30e hsa-miR-20a hsa-miR-15a hsa-miR-29c hsa-miR-30c hsa-let-7b hsa-miR -29a hsa-miR-15b hsa-miR-26a hsa-miR-223 hsa-let-7g
[00136] [00136] Decreased MicroRNA markers on monocytes (CD14+CD16- or CD14+CD16+ monocytes) in individuals who have ALS relative to healthy controls (CD14+CD16- or CD14+CD16+ monocytes in healthy controls) are listed in Table 4 Table 4. List of decreased microRNAs on CD14+CD16- or CD14+CD16+ monocytes in subjects who have ALS compared to healthy controls hsa-miR-518f hsa-miR-655 hsa-miR-421 hsa-miR-383 hsa- miR-206 hsa-miR-450b-5p hsa-miR-651 hsa-miR-649 hsa-miR-204 hsa-miR-548b-3p hsa-miR-379 hsa-miR-592 hsa-miR-137 hsa-miR -584 hsa-miR-193a-3p hsa-miR-2054 hsa-miR-453 hsa-miR-548f hsa-miR-515-3p hsa-miR-566 hsa-miR-603 hsa-miR-300 hsa-miR- 598 hsa-miR-494 hsa-miR-1297 hsa-miR-302c hsa-miR-513a-5p hsa-miR-142-3p hsa-miR-192 hsa-miR-328 hsa-miR-640 hsa-miR-1206 hsa-miR-526a hsa-miR-421 hsa-miR-548g hsa-miR-580 hsa-miR-615-5p hsa-miR-660
[00137] [00137] MicroRNA markers increased in CD14+ CD16- monocytes from ALS patients compared to CD14+CD16- monocytes from healthy controls are listed in Table 5. Table 5. List of increased microRNAs in CD14+ CD16- monocytes from patients with ALS versus CD14+CD16- monocytes from healthy controls hsa-miR-1260 hsa-let-7g hsa-miR-26a hsa-miR-500 hsa-miR-30a hsa-let-7b hsa-miR-16 hsa- miR-150 hsa-miR-423 hsa-let-7a hsa-miR-374b hsa-miR-30e hsa-miR-361-5p hsa-miR-574-3p hsa-miR-140-5p hsa-miR-29c hsa -miR-93 hsa-miR-26b hsa-miR-101 hsa-miR-29a hsa-miR-103 hsa-miR-532-3p hsa-miR-142-5p hsa-miR-223 hsa-miR-24 hsa- miR-19a hsa-miR-374a hsa-mIR-423 hsa-miR-221 hsa-let-7f hsa-miR-340 hsa-miR-1260 hsa-miR-20a hsa-miR-27a hsa-miR-21 hsa- miR-30a hsa-miR-30c hsa-miR-106b hsa-miR-155 hsa-miR-30b hsa-miR-181a hsa-miR-19b hsa-miR-146a hsa-miR-190 hsa-miR-15b
[00138] [00138] The microRNAs that are decreased in CD14+CD16- monocytes of ALS patients compared to CD14+CD16- monocytes of healthy controls are listed in Table 6. Table 6. List of microRNAs decreased in CD14+CD16 - monocytes from ALS patients in relation to CD14+CD16- monocytes from healthy controls hsa-miR-328 hsa-miR-513a-5p hsa-miR-302c hsa-miR-453 hsa-miR-651 hsa-miR- 640 hsa-miR-2054 hsa-miR-204 hsa-miR-379 hsa-miR-548g hsa-miR-584 hsa-miR-518f hsa-miR-300 hsa-miR-1206 hsa-miR-655 hsa-miR- 206 hsa-miR-548f hsa-miR-450b-5p hsa-miR-421 hsa-miR-192 hsa-miR-193a-hsa-miR-548b-3p hsa-miR-615-5p hsa-miR-566 3p hsa -miR-137 hsa-miR-383 hsa-miR-526a hsa-miR-598 hsa-miR-580 hsa-miR-649 hsa-miR-603 hsa-miR-515-3p hsa-miR-592 hsa-miR- 1297 hsa-miR-660
[00139] [00139] Exceptionally increased MicroRNA markers on CD14+CD16- monocytes from ALS patients relative to CD14+CD16- monocytes from MS subjects and healthy controls are listed in Table 7. Table 7. List of exceptionally microRNAs increased in CD14+CD16- monocytes from ALS patients compared to CD14+CD16- monocytes from individuals with MS and healthy controls hsa-miR-19b hsa-miR-16 hsa-miR-29c hsa-miR-181a hsa -miR-106b hsa-miR-374a hsa-miR-29a hsa-miR-103 hsa-miR-30b hsa-miR-374b hsa-miR-223 hsa-miR-155 hsa-miR-21 hsa-miR-101 hsa -miR-26a hsa-miR-532-3p hsa-miR-142-5p hsa-miR-340 hsa-miR-26b hsa-miR-24 hsa-miR-27a hsa-miR-30e
[00140] [00140] Exceptionally decreased MicroRNA markers on CD14+CD16- monocytes from ALS patients compared to CD14+CD16- monocytes from MS subjects and healthy controls are listed in Table 8. Table 8. List of exceptionally microRNAs decreased in CD14+CD16- monocytes from ALS patients compared to CD14+CD16- monocytes from individuals with MS and healthy controls hsa-miR-518f hsa-miR-603 hsa-miR-655 hsa-miR-300 hsa -miR-206 hsa-miR-1297 hsa-miR-450b-5p hsa-miR-302c hsa-miR-204 hsa-miR-192 hsa-miR-548b-3p hsa-miR-328 hsa-miR-137 hsa- miR-526a hsa-miR-584 hsa-miR-421 hsa-miR-453 hsa-miR-615-5p hsa-miR-548f hsa-miR-580
[00141] [00141] Increased MicroRNA markers on CD14+CD16+ monocytes of ALS patients compared to CD14+CD16+ monocytes of healthy controls are listed in Table 9. Table 9. List of increased microRNAs on CD14+CD16+ monocytes of patients with ALS in relation to CD14+CD16+ monocytes of healthy controls hsa-miR-708 hsa-miR-24 hsa-miR-26a hsa-miR-21 hsa-miR-142-5p hsa-miR-103 hsa-miR-30b hsa-miR-142-3p hsa-miR-15b hsa-miR-23a hsa-miR-16 hsa-miR-340 hsa-miR-223 hsa-miR-29a hsa-miR-15a hsa-let-7i
[00142] [00142] Decreased MicroRNA markers on CD14+CD16+ monocytes from ALS patients compared to CD14+CD16+ monocytes from healthy controls are listed in Table 10. Table 10. List of microRNAs decreased in CD14+CD16+ monocytes from ALS patients in relation to CD14+CD16+ monocytes of healthy controls hsa-miR-598 hsa-miR-494 hsa-miR-142-3p
[00143] [00143] Markers of exceptionally increased MicroRNA in the CSF of individuals who have sporadic ALS or familial ALS compared to the CSF of healthy controls are listed in Table 11. Table 11. List of exceptionally increased microRNAs in the CSF of individuals who have ALS sporadic or familial ALS in
[00144] [00144] The increased microRNA markers on monocytes (CD14+CD16- or CD14+CD16+ monocytes) in individuals who have healthy controls relative to MS (Cd14+CD16- or CD14+CD16+ in healthy controls) are listed in Table 12 Table 12. List of microRNAs increased in CD14+CD16- or CD14+CD16+ monocytes in subjects who have MS relative to CD14+CD16- or CD14+CD16+ monocytes in healthy controls hsa-miR-320c hsa-miR -1260 hsa-miR-19b hsa-miR-340 hsa-let-320a hsa-miR-27b hsa-miR-720 hsa-miR-106b hsa-miR-26b hsa-miR-520g hsa-miR-664 hsa-miR -1274a hsa-let-7g hsa-miR-1260 hsa-miR-204 hsa-miR-432-5p hsa-miR-423 hsa-miR-181a hsa-miR-361-5p hsa-miR-29a hsa-miR- 92a hsa-miR-197 hsa-miR-140-5p hsa-miR-374b hsa-miR-23a hsa-miR-24 hsa-miR-30a hsa-miR-142-5p hsa-let-7a hsa-miR-142 -3p hsa-miR-93 hsa-miR-221 hsa-miR-19a hsa-miR-532-3p hsa-miR-103 hsa-miR-20a hsa-miR-361-5p hsa-let-7b hsa-miR- 155 hsa-miR-15a hsa-miR-let-7a hsa-miR-103 hsa-miR-221 hsa-miR-27a hsa-miR-21 hsa-miR-3 0c hsa-miR-16 hsa-miR-15b hsa-miR-146a hsa-miR-223 hsa-miR-181a hsa-miR-30b hsa-miR-574-3p hsa-let-7i hsa-miR-1274b hsa- miR-423 hsa-miR-26a hsa-let-7f hsa-let-191
[00145] [00145] Decreased microRNA markers on monocytes (CD14+CD16- or CD14+CD16+ monocytes) in individuals who have healthy controls relative to MS (CD14+CD16- or CD14+CD16+ monocytes in healthy controls) are listed in the Table 13. Table 13. List of decreased microRNAs on CD14+CD16- or CD14+CD16+ monocytes in individuals with MS compared to CD14+CD16- or CD14+CD16+ monocytes in healthy controls hsa-miR-649 hsa-miR- 362-3p hsa-miR-603 hsa-miR-15a hsa-miR-383 hsa-miR-450b-5p hsa-miR-584 hsa-miR-1537 hsa-miR-1206 hsa-miR-302c hsa-miR-204 hsa-miR-148b hsa-miR-548g hsa-miR-548f hsa-miR-526a hsa-miR-369-3p hsa-miR-640 hsa-miR-328 hsa-miR-453 hsa-miR-615-5p hsa -miR-592 hsa-miR-580 hsa-miR-2054 hsa-miR-10a hsa-miR-598 hsa-miR-421 hsa-miR-655 hsa-miR-30d hsa-miR-515-3p hsa-miR- 1297 hsa-miR-518f hsa-miR-494 hsa-miR-513a-5p hsa-miR-548b-3p hsa-miR-206 hsa-miR-142-3p hsa-miR-651 hsa-miR-615-5p hsa -miR-192 hsa-miR-651 hsa-miR-379 hsa-miR-137 hsa-miR-450a hsa-miR- 193a-3p hsa-miR-300 hsa-miR-566
[00146] [00146] Markers increased in CD14+CD16- monocytes of MicroRNA from MS patients in relation to CD14+CD16- monocytes from patients with MS are listed in Table 14. Table 14. List of increased microRNAs in CD14+CD16- mono- cytos from MS patients in relation to CD14+CD16- monocytes from healthy controls hsa-miR-720 hsa-miR-20a hsa-let-7g hsa-miR-26b hsa-miR-1274a hsa-miR-93 hsa-miR- 181a hsa-miR-21 hsa-miR-320c hsa-miR-361-5p hsa-140-5p hsa-miR-374b hsa-miR-27b hsa-miR-423 hsa-142-5p hsa-let-7a hsa- miR-664 hsa-miR-24 hsa-miR-19a hsa-miR-532-3p hsa-miR-1260 hsa-miR-103 hsa-let-7b hsa-miR-155 hsa-miR-423 hsa-miR-16 hsa-miR-15b hsa-miR-27a hsa-miR-197 hsa-miR-30b hsa-miR-574-3p hsa-miR-146a hsa-miR-30a hsa-miR-26a hsa-let-7f hsa-miR -92a hsa-miR-30c hsa-miR-19b hsa-miR-340 hsa-miR-1274b hsa-miR-221 hsa-miR-106b hsa-miR-101
[00147] [00147] Decreased MicroRNA markers in CD14+CD16- monocytes from MS patients compared to CD14+CD16- mo-
[00148] [00148] Exceptionally increased MicroRNA markers on CD14+CD16- monocytes from MS patients relative to CD14+CD16- monocytes from ALS subjects and healthy controls are listed in Table 16. Table 16. List of exceptionally microRNAs increased in CD14+CD16- monocytes of patients with MS in relation to CD14+CD16- monocytes of individuals with ALS and healthy controls hsa-miR-320c hsa-miR-664 hsa-miR-92a hsa-miR-27b hsa -miR-432-5p
[00149] [00149] Exceptionally decreased MicroRNA markers on CD14+CD16- monocytes from MS patients compared to CD14+CD16- monocytes from ALS individuals and healthy controls are listed in Table 17. Table 17. List of exceptionally microRNAs decreased in CD14+CD16- monocytes from patients with MS compared to CD14+CD16- monocytes from individuals with ALS and healthy controls hsa-miR-142-3p hsa-miR-1537 hsa-miR-148b hsa-miR- 15a hsa-miR-362-3p
[00150] [00150] MicroRNA markers increased in CD14+CD16+ monocytes from MS patients compared to CD14+CD16+ monocytes from healthy controls are shown in Table 18. Table 18. List of increased microRNAs in CD14+CD16+ monocytes from patients with MS. MS compared to CD14+CD16+ monocytes from healthy controls hsa-let-7i hsa-miR-520g hsa-miR-24 hsa-miR-21 hsa-miR-191 hsa-miR-204 hsa-miR-30b hsa-miR- 16 hsa-miR-1260 hsa-miR-340 hsa-miR-142-3p hsa-miR-142-5p hsa-miR-720 hsa-miR-15b hsa-miR-103 hsa-miR-223 hsa-miR-1274a hsa-miR-29a hsa-miR-15a hsa-miR-320a hsa-miR-23a hsa-miR-26a
[00151] [00151] Decreased MicroRNA markers in CD14+CD16+ monocytes from MS patients compared to CD14+CD16+ monocytes from healthy controls are listed in Table 19. Table 19. List of decreased microRNAs in CD14+CD16+ monocytes from MS patients versus healthy controls CD14+CD16+ monocytes hsa-miR-369-3p hsa-miR-10a hsa-miR-598 hsa-miR-615-5p hsa-miR-30d hsa-miR-494
[00152] [00152] Decreased inflammatory markers on CD14+CD16- monocytes of patients who have neurodegenerative disorders relative to CD14+CD16- monocytes of healthy controls are listed in Table 20. Table 20. List of decreased inflammatory markers on CD14+ CD16- monocytes from patients who have neurodegenerative disorders compared to CD14+CD16- monocytes from healthy controls
[00153] [00153] Exceptionally increased inflammatory markers on CD14+CD16- monocytes from patients who have neurodegenerative disorders relative to CD14+CD16- monocytes from healthy controls are listed in Table 21. Table 21. List of increased inflammatory markers in CD14+ CD16- monocytes from patients who have neurodegenerative disorders compared to CD14+CD16- monocytes from healthy controls
[00154] [00154] Here are provided methods of diagnosing a disorder.
[00155] [00155] In some embodiments, an individual may be diagnosed as having a neurodegenerative disorder if the level of one or more or more (eg, at least two, three, four, five or six) microRNAs listed in Table 1 in CSF or if an individual's CD14+ CD16+ and CD14+CD16- monocyte (e.g., peripheral or blood-derived monocyte) is increased compared to a reference level of one or more of the microRNAs listed in Table 1, and/or if the level of one or more (e.g. at least two, three, four, five or six) microRNAs listed in Table 2 in the CSF or if a CD14+CD16+ and CD14+CD16- monocyte (e.g. peripheral or blood-derived monocyte) of the individual is decreased compared to a reference level of one or more microRNAs listed in Table 2.
[00156] [00156] In some embodiments, an individual may be diagnosed as having a neurodegenerative disorder if the level of one or more (eg, at least two, three, four, five, or six)
[00157] [00157] In some embodiments, an individual may be diagnosed as having a neurodegenerative disorder if the level of one or more (eg, at least two, three, four, five, or six) microRNAs listed in Table 5 and in Table 14, and/or one or more inflammatory markers (e.g., at least two, three, four, five, or six) in Table 21 in an individual's CD14+CD16-monocyte is increased compared to a level of reference of one or more microRNAs listed in Table 5 and Table 14 and/or a reference level of one or more inflammatory markers listed in Table 21; and/or if the level of one or more (e.g. at least two, three, four, five or six) microRNAs listed in Table 6 and Table 15, and/or one or more (e.g. at least two, three, four, five or six) inflammatory markers in the Table in an individual's CD14+CD16- monocyte is decreased compared to a reference level of one or more microRNAs listed in Table 6 and Table 15 and/or a reference level of one or more inflammatory markers listed in Table 20.
[00158] [00158] In some modalities, an individual may be diagnosed as having amyotrophic lateral sclerosis if the level of one or more (eg, at least two, three, four, five, or six) microRNAs listed in Tables 5 and 7, and/or one or more (e.g. at least two, three, four, five or six) inflammatory markers.
[00159] [00159] In some modalities, an individual may be diagnosed as having amyotrophic lateral sclerosis if the level of one or more (eg, at least two, three, four, five, or six) microRNAs listed in Table 9 in an individual's CD14+CD16+ monocyte is increased compared to a reference level of one or more of the microRNAs listed in Table 9, and/or if the level of one or more (e.g., one, two, or three) related microRNAs is in Table 10 in an individual's CD14+CD16+ monocyte is decreased compared to a reference level of one or more microRNAs listed in Table 10.
[00160] [00160] In some embodiments, an individual may be diagnosed as having amyotrophic lateral sclerosis if the level of one or more (eg, at least two, three, four, five or six) of hsa-miR-27b, hsa -miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p is increased in the subject's cerebrospinal fluid compared to a reference level of hsa-miR-27b , hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p.
[00161] [00161] In some embodiments, an individual may be diagnosed
[00162] [00162] In the modalities, an individual can be diagnosed as having sporadic ALS if the level of two or more (e.g., two, three, four, five or six) microRNAs selected from hsa-27b, hsa-miR-99b, hsa -miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p in the subject's cerebrospinal fluid is increased compared to a reference level of one or more microRNAs. In the modalities, an individual can be diagnosed as having sporadic ALS if the level of one or more (e.g., two, three, four, or five) microRNAs selected from hsa-miR-99b, hsa-miR- 146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p in the subject's cerebrospinal fluid is increased compared to a reference level of one or more microRNAs.
[00163] [00163] In some embodiments, an individual may be diagnosed as having multiple sclerosis if the level of one or more (eg, at least two, three, four, five, or six) microRNAs in Table 14 and Table 16, and/or one or more (e.g., at least two, three, four, five, or six) inflammatory markers in Table 21 in an individual's CD14+CD16-monocyte is increased compared to a reference level of one or more more microRNAs listed in Table 14 and Table 16 and/or the reference level of one or more inflammatory markers listed in Table 21; and/or if the level of one or more (e.g. at least two, three, four,
[00164] [00164] In some modalities, an individual may be diagnosed as having multiple sclerosis if the level of one or more (eg, at least two, three, four, five or six) microRNAs in Table 18 at CD14+ The individual's CD16+ monocyte is increased compared to a reference level of one or more microRNAs in Table 18 and/or if the level of one or more (eg, at least two, three, four, five or six) microRNAs in Table 19 in an individual's CD14+CD16+ monocyte is decreased compared to a reference level of one or more microRNAs listed in Table 19.
[00165] [00165] The levels of one or more microRNAs (mature and precursor microRNAs) described in Tables 1-19 can be determined using molecular biology methods known in the art. For example, levels of any of the microRNAs described herein can be measured using techniques that include the use of a polymerase chain reaction (PCR) and appropriate primers, eg quantitative real-time PCR (qRT-PCR). Primers for each of the precursor and mature microRNAs described herein can be designed using methods known in the art. Likewise, levels of an mRNA encoding any of the inflammatory markers in Tables 20 and 21 can be determined using techniques that include the use of PCR and appropriate primers. For example, a primer can contain at least 7 (e.g. at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) contiguous nucleotides that are complementary to a sequence present in the target microRNA or in the mRNA of the target inflammatory markers. Primers may include one or more of the modifications described herein (e.g., one or more backbone modifications, one or more nucleobase(s) modifications, and one or more sugar(s) modifications). ). Primers can also include a tag (eg, a radioisotope or a fluorophore). Primers can also be conjugated to secondary molecules or agents in order to enhance the stability of the primers (as described herein).
[00166] [00166] The levels of a protein encoded by the inflammatory marker genes listed in Tables 20 and 21 can be detected using a series of techniques known in the art that use antibodies that specifically bind to one of the proteins listed in Tables 20 and 21 (eg, immunoblot).
[00167] [00167] Any of the methods described herein may additionally include obtaining or collecting a sample from an individual (eg, a biological sample that contains peripheral blood or cerebrospinal fluid). In some embodiments, the methods (e.g., any of the methods described herein) additionally include purifying a monocyte (e.g., a CD14+CD16-monocyte or a CD14+CD16+ monocyte from a biological sample of the subject). ). Methods of purifying a CD14+CD16-monocyte or a CD14+CD16+ monocyte can be performed using a variety of methods known in the art, for example antibody-based methods such as fluorescence-assisted cell sorting. (FACS).
[00168] [00168] Any of the methods described here can be performed on patients who attend a health care facility (eg, a hospital, clinic, or an assisted care facility). Individuals may present with one or more symptoms of a neurodegenerative disorder (eg, any of the symptoms of a neurodegenerative disorder described here). The individual may also present with no symptoms (an asymptomatic individual) or only a symptom of a neurodegenerative disorder. The individual may have a family history of a neurodegenerative disorder (eg, familial ALS).
[00169] [00169] The diagnostic methods described here can be performed by any healthcare professional (eg, a physician, laboratory technician, nurse, physician assistant, and nursing assistant). The diagnostic methods described herein may be used in combination with all additional diagnostic test methods known in the art (e.g., observation or assessment of one or more symptoms of a neurodegenerative disorder in an individual). Methods of Selecting an Individual for Treatment
[00170] [00170] Methods of selecting an individual for the treatment of a neurodegenerative disorder are also provided. These methods include determining a level of one or more (eg, at least two, three, four, five or six) microRNAs listed in Tables 1-19 and/or the level of one or more (eg, at least two, three, four, five or six) inflammatory markers listed in Tables 20 and 21 in the cerebrospinal fluid or an individual's CD14+CD16+ and CD14+CD16- monocyte; comparing the level of one or more microRNAs in the cerebrospinal fluid or in an individual's CD14+CD16+ and CD14+CD16- monocyte to a reference level of one or more microRNAs and/or a reference level of one or more markers inflammatory; and selecting an individual that has an increase in the level of one or more (e.g., at least two, three, four, five, or six) microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16 or 18, and/or one or more (e.g. at least two, three, four, five or six) inflammatory markers listed in Table 21 in cerebrospinal fluid or on a CD14+CD16+ and CD14+CD16- individual's monocyte compared to a reference level of one or more microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16 or 18, and/or a reference level of one or more markers inflammatory diseases listed in Table 21; and/or a decrease in the level of one or more (eg, at least two, three, four, five or six) microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17 and 19, and/or one or more (e.g., at least two, three, four, five or six) inflammatory markers listed in Table 20 in the cerebrospinal fluid or on a CD14+CD16+ and CD14+CD16- monocyte of the individual compared at a reference level of one or more microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17 and 19, and/or a reference level of one or more inflammatory markers listed in Table 20 for the treatment of a neurodegenerative disorder.
[00171] [00171] An individual may be selected for treatment based on the relative expression of one or more (eg, at least two, three, four, five, or six) microRNAs listed in Tables 1-19 and/or one or more ( for example, at least two, three, four, five or six) inflammatory markers listed in Tables 20 and 21, as described in the section above describing the diagnostic methods. For example, an increase in the level of one or more (eg, at least two, three, four, five or six) microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14 , 16 or 18 and/or the level of one or more (eg, at least two, three, four, five or six) inflammatory markers listed in Table 21 (compared to a reference level), as used to diagnose a individual
[00172] [00172] The levels of one or more microRNAs (mature and precursor microRNAs) described in Tables 1-19 can be determined using molecular biology methods known in the art. For example, levels of any of the microRNAs described herein can be measured using techniques that include the use of a polymerase chain reaction (PCR) and appropriate primers, eg quantitative real-time PCR (qRT-PCR). Primers for each of the precursor and mature microRNAs described herein can be designed using methods known in the art. Likewise, levels of an mRNA encoding any of the inflammatory markers in Tables 20 and 21 can be determined using techniques that include the use of PCR and appropriate primers. For example, a primer can contain at least 7 (e.g. at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) contiguous nucleotides that are complementary to a sequence present in the target microRNA or in the mRNA of the target inflammatory markers. Primers may include one or more of the modifications described herein (e.g., one or more backbone modifications, one or more modifications to the nucleobase(s), and one or more modifications to the nucleobase(s).
[00173] [00173] Individuals may present with one or more symptoms (eg, at least two, three, or four) of a neurodegenerative disorder (eg, any of the symptoms of a neurodegenerative disorder described herein). The individual may also present with no symptoms or only one symptom of a neurodegenerative disorder. The individual may have a family history of a neurodegenerative disorder (eg, familial ALS). The individual may be previously diagnosed as having a neurodegenerative disorder.
[00174] [00174] Treatments for neurodegenerative disorders that may be administered to the individual include riluzole, corticosteroids, beta-interferon, glatiramer, fingolimod, natalizumab, mitoxantrone, muscle relaxants, and amantadine. Additional treatments for neurodegenerative disorders include physical therapy and plasmapheresis. Methods of Identifying an Individual at Risk of Developing a Neurodegenerative Disorder
[00175] [00175] Methods of identifying an individual at risk of developing a neurodegenerative disorder are also provided. These methods include determining a level of one or more (e.g. at least two, three, four, five or six) microRNAs listed in Tables 1-19 and/or one or more (e.g. at least two, three , four, five or six) inflammatory markers listed in Tables 20 and 21 in cerebrospinal fluid or CD14+
[00176] [00176] In some modalities, an individual is identified as having a decreased risk of developing a neurological disorder if the level of one or more (eg, at least two, three, four, five or six) microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18, and/or one or more (eg, at least two, three, four, five, or six) inflammatory markers listed in Table 21 in fluid cerebrospinal or on an individual's CD14+CD16+ and CD14+CD16- monocyte are decreased or not significantly altered compared to a reference level of one or more microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16 or 18, and/or a reference level of one or more inflammatory markers listed in Table 21; and/or the level of one or more (e.g. at least two, three, four, five or six) microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17 and 19, and/or one or more (eg, at least two, three, four, five, or six) inflammatory markers listed in Table 20 in the cerebrospinal fluid or an individual's CD14+CD16+ and CD14+CD16- monocyte is increased or not significantly changed compared to a reference level of one or more microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17 and 19, and/or a reference level of one or more inflammatory markers listed in Table 20.
[00177] [00177] In some modalities, an individual may be identified as having an increased or decreased risk of developing a neurodegenerative disorder based on the relative expression of one or more (e.g., at least two, three, four, five, or six ) microRNAs listed in Tables 1-19 and/or one or more (eg, at least two, three, four, five or six) inflammatory markers listed in Tables 20 and 21 in cerebrospinal fluid or CD14 +CD16- or CD14+CD16+ of the individual's monocyte compared to a reference value, as described in the section above that describes diagnostic methods. For example, an increase in the level of one or more (e.g. at least two, three, four, five or six) microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16 and 18 and/or at the level of one or more (eg, at least two, three, four, five or six) inflammatory markers listed in Table 21 in cerebrospinal fluid or a CD14+CD16+ and CD14+CD16-mo-
[00178] [00178] In some embodiments, an increase in the level of one or more (e.g., at least two, three, four, five or six) microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15 , 17 or 19 and/or at the level of one or more (e.g. at least two, three, four, five or six) inflammatory markers listed in Table 20 in cerebrospinal fluid or CD14+CD16- or CD14+CD16+ monocyte individual (compared to a reference level), when a decrease in the level of one or more microRNAs or a decrease in the level of one or more inflammatory markers indicates a diagnosis of a neurodegenerative disease (as detailed in the section above that describes the diagnostic methods), indicates that the individual has a decreased risk of developing a neurodegenerative disorder. In some embodiments, a decrease in the level of one or more (e.g., at least two, three, four, five or six) microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16 and 18 or at the level of one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Table 21 in the individual's cerebrospinal fluid or CD14+CD16- or CD14+CD16+ monocyte (in comparison to a reference level), when an increase in the level of one or more microRNAs or an increase in the level of one or more inflammatory markers indicates a diagnosis of a neurodegenerative disorder (as detailed in the section above that describes diagnostic methods), indicates that the individual has a decreased risk of developing a neurodegenerative disorder.
[00179] [00179] In some of the methods described here, increased or decreased risk is relative to an individual who does not have an increase or decrease in levels of one or more (eg, at least two, three, four, five or six) microRNAs listed in Tables 1-19 and/or do not have an increase or decrease in levels of one or more (e.g., at least two, three, four, five or six) inflammatory markers listed in Tables 20 and 21 (by and - e.g. an individual who has not been diagnosed as having a neurodegenerative disorder using the methods described herein).
[00180] [00180] Levels of any of the microRNAs in Tables 1-19 or levels of any of the inflammatory markers listed in Tables 20 and 21 can be performed using standard molecular biology methods (e.g., methods based on on PCR and based on the antibody described herein). The methods can be performed by any health care professional (eg, a physician, nurse, physician assistant, laboratory technician, or nursing assistant).
[00181] [00181] Individuals may present with one or more symptoms of a neurodegenerative disorder (eg, any of the symptoms of a neurodegenerative disorder described herein). The individual may also present with no symptoms or only one symptom of a neurodegenerative disorder. The individual may have a family history of a neurodegenerative disorder (eg, familial ALS).
[00182] [00182] Individuals identified as having an increased risk of developing a neurodegenerative disease may receive treatment for a neurodegenerative disorder or may receive a new or alternative treatment for a neurodegenerative disorder. Individuals identified as having an increased risk of developing a neurodegenerative disorder may also undergo more aggressive therapeutic treatment (eg, increased frequency of clinic or hospital visits). Disease Progression Rate Prediction Methods
[00183] [00183] Methods of predicting the rate of disease progression in an individual having a neurodegenerative disorder are also provided. These methods include determining a level of one or more (e.g., at least two, three, four, five, or six) microRNAs listed in Tables 1-19 and/or one or more (e.g., at least two , three, four, five or six) inflammatory markers listed in Tables 20 and 21 in the individual's cerebrospinal fluid or CD14+CD16- or CD14+CD16+ monocyte; the comparison of the level of one or more microRNAs and/or of one or more inflammatory markers to a reference level of one or more microRNAs and/or a reference level of one or more inflammatory markers. An individual is predicted to have an increased rate of disease progression if the level of one or more (eg, at least two, three, four, five or six) microRNAs listed in Tables 1, 3, 5, 7, 9 , 11, 12, 14, 16 or 18, and/or one or more (e.g. at least two, three, four, five or six) inflammatory markers listed in Table 21 in cerebrospinal fluid or a CD14 +CD16+ and CD14+CD16- monocyte of the individual are increased compared to a reference level of one or more related microRNAs.
[00184] [00184] In some modalities, an individual is predicted to have a slower or average rate of disease progression if the level of one or more (e.g., at least two, three, four, five, or six) related microRNAs in the Tables 1, 3, 5, 7, 9, 11, 12, 14, 16 or 18, and/or one or more (e.g. at least two, three, four, five or six) inflammatory markers listed in Table 21 in the cerebrospinal fluid or on an individual's CD14+CD16+ and CD14+CD16- monocyte are decreased or not significantly altered compared to a reference level of one or more microRNAs listed in Tables 1, 3, 5, 7, 9, 11 , 12, 14, 16 or 18, and/or a reference level of one or more inflammatory markers listed in Table 21; and/or the level of one or more (e.g. at least two, three, four, five or six) microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17 and 19, and/or one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Table 20 in the cerebrospinal fluid or an individual's CD14+CD16+ and CD14+CD16- monocyte is increased or not significantly altered compared to a reference level of one or more microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17 and 19, and/or a reference level of one or more inflammatory markers listed in the Table 20.
[00185] [00185] In some embodiments, an individual is predicted to have an increased or decreased rate of disease progression based on the relative expression of one or more (eg, at least two, three, four, five, or six) microRNAs listed in Tables 1-19 and/or one or more (eg, at least two, three, four, five or six) inflammatory markers listed in Tables 20 and 21 in cerebrospinal fluid or CD14+CD16- or CD14 +CD16+ individual's monocyte compared to a reference value, as described in the section above that describes diagnostic methods. For example, an increase in the level of one or more (e.g. at least two, three, four, five or six) microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14 , 16 and 18, and/or at the level of one or more (eg, at least two, three, four, five or six) inflammatory markers listed in Table 21 in cerebrospinal fluid or CD14+CD16- or CD14+CD16+ monocyte of the individual (compared to a reference level), as used to diagnose an individual as having a neurodegenerative disorder, can likewise be used to predict an increased rate of disease progression. Similarly, a decrease in the level of one or more (e.g. at least two, three, four, five or six) microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17 and 19 and/or at the level of one or more (e.g. at least two, three, four, five or six) inflammatory markers listed in Table 20 in cerebrospinal fluid or CD14+CD16- or CD14+CD16+ monocyte (compared to a reference level ), as used to diagnose an individual as having a neurodegenerative disorder, can likewise be used to predict an increased rate of disease progression.
[00186] [00186] In some embodiments, an increase in the level of one or more (e.g., at least two, three, four, five or six) microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15 , 17 and 19, and/or at the level of one or more (e.g. at least two, three, four, five or six) inflammatory markers in Table 20 in cerebrospinal fluid or CD14+CD16- or CD14+CD16+ individual's monocyte (compared to a reference level), when a decrease in the level of one or more microRNAs and/or a decrease in the level of one or more inflammatory markers indicates a diagnosis of a neurodegenerative disease (as detailed in the section above which describes diagnostic methods), can be used to predict a decreased or average rate of disease progression. In some modalities, a decrease in the level of one or more (eg, at least two, three, four, five or six) microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16 or 18, and/or at the level of one or more (e.g. at least two, three, four, five or six) inflammatory markers listed in Table 21 in cerebrospinal fluid or CD14+CD16- or CD14 +CD16+ monocyte of the individual (compared to a reference level), when an increase in the level of one or more microRNAs and/or an increase in the level of one or more inflammatory markers indicates a diagnosis of a neurodegenerative disorder. (as detailed in the section above that describes diagnostic methods), can be used to predict a decreased or average rate of disease progression.
[00187] [00187] In some modalities, the rate of disease progression is the rate of onset of one or more (e.g., one, two, three, or four) symptoms of a neurodegenerative disorder (e.g., ataxia), the rate of intensity of increase (worsening) of symptoms of a neurodegenerative disorder, the frequency of one or more symptoms of a neurodegenerative disorder, the duration of one or more symptoms of a neurodegenerative disorder, or the longevity of the individual. For example, an increase in the rate of disease progression may be manifested by one or more of: an increase in the rate of onset of one or more (new) symptoms of a neurodegenerative disorder, an increase in the rate of intensity of increase (worsening) of one or more symptoms of a neurodegenerative disorder, an increase in the duration of one or more symptoms of a neurodegenerative disorder, and a decrease in the individual's longevity.
[00188] [00188] The rate of disease progression determined using the methods described herein can be compared to the rate of disease progression in individuals who do not have an increase or decrease in the level of one or more (e.g., at least two, three, four, five or six) microRNAs listed in Tables 1-19 and/or do not have an increase or decrease in the level of one or more (e.g. at least two, three, four, five or six) inflammatory markers listed in the Tables 20 and 21 on your CSF or on a CD14+ CD16+ and CD14+CD16- monocyte. In some modalities, the rate of disease progression can be compared to the average rate of disease progression for all individuals diagnosed as having the same neurodegenerative disease.
[00189] [00189] Levels of any of the microRNAs in Tables 1-19 or levels of any of the inflammatory markers listed in Tables 20 and 21 can be performed using standard molecular biology methods (e.g., methods based on on PCR and based on the antibody described herein). The methods can be performed by any health care professional (eg, a physician, nurse, physician assistant, laboratory technician, or nursing assistant).
[00190] [00190] Individuals may present with one or more (eg, one, two, three, or four) symptoms of a neurode-
[00191] [00191] Some modalities of these additional methods include administering a treatment to an individual with prediction of an increased rate of disease progression. In some modalities, an individual predicted to have an increased rate of disease progression receives more aggressive treatment (eg, increased frequency of clinic visits). Methods of Selecting an Individual for Participation in a Clinical Trial
[00192] [00192] Methods for selecting an individual for participation in a clinical trial are also provided. These methods include determining a level of one or more (e.g. at least two, three, four, five or six) microRNAs listed in Tables 1-19 and/or one or more (e.g. at least two, three , four, five or six) inflammatory markers listed in Tables 20 and 21 in the individual's cerebrospinal fluid or CD14+CD16- or CD14+CD16+ monocyte; comparing the level of one or more microRNAs and/or the level of one or more inflammatory markers to a reference level of one or more microRNAs and/or a reference level of one or more inflammatory markers and selecting an individual who has an increase or decrease in the level of one or more microRNAs and/or one or more inflammatory markers in the cerebrospinal fluid or the individual's CD14+CD16- or CD14+CD16+ monocyte compared to the reference level (such as described in detail below)
[00193] [00193] In some modalities, an individual is selected for participation in a clinical trial if the level of one or more (eg, at least two, three, four, five or six) microRNAs listed in Tables 1 , 3, 5, 7, 9, 11, 12, 14, 16, or 18, and/or one or more (eg, at least two, three, four, five, or six) inflammatory markers listed in Table 21 in the cerebrospinal fluid or on an individual's CD14+CD16+ and CD14+CD16- monocyte is decreased or not significantly altered compared to the reference level of one or more related microRNAs in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16 or 18, and/or a reference level of one or more inflammatory markers listed in Table 21; and/or the level of one or more (e.g. at least two, three, four, five or six) microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17 and 19, and/or one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Table 20 in the cerebrospinal fluid or an individual's CD14+CD16+ and CD14+CD16- monocyte is increased or not significantly altered compared to a reference level of one or more microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17 and 19, and/or a reference level of one or more related inflammatory markers. mentioned in Table 20.
[00194] [00194] In some modalities, an individual may be selected for participation in a clinical trial based on the relative expression of one or more (eg, at least two, three, four, five, or six) microRNAs listed in Tables 1-19 and/or one or more (eg, at least two, three, four, five or six) inflammatory markers listed in Tables 20 and 21 in cerebrospinal fluid or CD14+CD16- or CD14+CD16+ individual's monocyte compared to a reference value, as described in the section above that describes diagnostic methods. For example, an increase in the level of one or more (e.g. at least two, three, four, five or six) microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16 and 18 , and/or at the level of one or more (eg, at least two, three, four, five, or six) inflammatory markers listed in Table 21 in the individual's cerebrospinal fluid or CD14+CD16- or CD14+CD16+ monocyte (compared to a reference level), as used to diagnose an individual as having a neurodegenerative disorder, may similarly be used to select an individual for participation in a clinical trial. Similarly, a decrease in the level of one or more (for example,
[00195] [00195] In some modalities, an increase or no significant change in the level of one or more (eg, at least two, three, four, five or six) microRNAs listed in Tables 2, 4, 6, 8, 10 , 13, 15, 17 and 19 and/or at the level of one or more (eg, at least two, three, four, five or six) inflammatory markers listed in Table 20 in cerebrospinal fluid or CD14+ CD16- or CD14+CD16+ monocyte of the individual (compared to a reference level), when a decrease in the level of one or more microRNAs and/or a decrease in the level of one or more inflammatory markers indicates a diagnosis of a neurodegenerative disease (as detailed in the section above describing diagnostic methods), can be used to select an individual for participation in a clinical trial (eg, as a control individual). In some modalities, a decrease or no significant change in the level of one or more (e.g., at least two, three, four, five or six) microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16 or 18 and/or at the level of one or more (eg at least two, three, four, five or six) inflammatory markers listed in Table 21 in cerebrospinal fluid or CD14+CD16 - or the individual's CD14+CD16+ monocyte (compared to a reference level), when an increase in the level of one or more microRNAs and/or an increase in the level of one or more inflammatory markers indicates a diagnosis of a neurodegenerative disorder (as detailed in the section above that describes diagnostic methods), can be used to select an individual for participation in a clinical trial.
[00196] [00196] Levels of any of the microRNAs in Tables 1-19 or levels of any of the inflammatory markers listed in Tables 20 and 21 can be performed using standard molecular biology methods (e.g., methods based on on PCR and based on the antibody described herein). The methods can be performed by any health care professional (eg, a physician, nurse, physician assistant, laboratory technician, or nursing assistant).
[00197] [00197] In some embodiments, the individual may present with one or more symptoms of a neurodegenerative disorder (eg, any of the symptoms of a neurodegenerative disorder described herein). In some modalities, the individual may also present with no symptoms or only one symptom of a neurodegenerative disorder. In some modalities, the individual may have a family history of a neurodegenerative disorder (eg, familial ALS). In some embodiments, the individual may already be diagnosed as having a neurodegenerative disorder. Treatment Methods
[00198] [00198] Also provided are methods of treating a neurodegenerative disorder that include administering to a subject at least one (e.g., at least two, three, four, five, or six) agents (e.g., an acid nucleic acid) that decreases the level or activity of one or more (e.g. at least two, three, four, five or six) microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16 or 18 (for example, an inhibitory nucleic acid,
[00199] [00199] In some embodiments, the subject receives at least one inhibitor nucleic acid that comprises a sequence that is complementary to a contiguous sequence present in hsa-miR-155 (e.g., a contiguous sequence present in hsa-miR-155 ma- hard or precursor). In non-limiting embodiments, the inhibitor nucleic acid can be an antisense oligonucleotide, a ribozyme, a siRNA, or an antagomir. In some embodiments, at least one inhibitor nucleic acid is injected into a subject's cerebrospinal fluid. In some embodiments, the injection is an intracranial injection or intrathecal injection. In some embodiments, at least one inhibitor nucleic acid is complexed with one or more cationic polymers.
[00200] [00200] In some embodiments, the inhibitory nucleic acid that lowers miR-155 levels is the antagomir-155 LNA sequence +TC+AC+A+A+TTA+G+C+ AT+T+A (SEQ ID NO.: 262) (where + indicates the presence of an LNA moiety). Methods for designing antagomirs to target microRNA molecules are described in Obad et al., Nature Genetics 43:371-378, 2011. Additional inhibitory nucleic acids to decrease hsa-miR-155 levels or expression are described in Worm et al., Nucleic Acids Res. 37:5784-5792, 2009 and Murugaiyan et al., J. Immunol. 187:2213-2221, 2011.
[00201] [00201] An individual may receive at least one (e.g., at least 2, 3, 4, or 5) dose of the agent (e.g., one or more inhibitory nucleic acids). The agent (e.g., one or more inhibitory nucleic acids) may be administered to the subject at least once a day (e.g., twice a day, three times a day, and four times a day), at least once a week (eg twice a week, three times a week, four times a week), and/or at least once a month. An individual may be treated (e.g., receive the agent periodically) for an extended period of time (e.g., at least one month, two months, six months, one year, two years, three years, four years, or five years). years old). As described in detail in the present invention, the dosage of the agent to be administered to the subject can be determined by a physician by considering a number of physiological factors that include, but are not limited to, the subject's sex, subject's weight, subject's age, individual and the presence of other medical conditions. The agent can be administered to the subject orally, intravenously, intra-arterially, subcutaneously, intramuscularly, intracranially, or by injection into the cerebrospinal fluid. Likewise, the agent can be formulated as a solid carrier (e.g., for oral administration) or physiologically acceptable liquid (e.g., saline) (e.g., for intravenous, intravascular administration, etc.). arterial, subcutaneous, intramuscular, cerebrospinal (intrathecal) or intracranial). In some embodiments, the agent (e.g., one or more inhibitory nucleic acids) may be administered by injection or may be administered by infusion over a period of time.
[00202] [00202] Agents to be administered to a subject for the treatment of a neurodegenerative disorder are described below and may be used in any combination (e.g., at least one, two, three, four, or five of any combination of the agents or classes of agents described below). Inhibitory Nucleic Acids
[00203] [00203] Inhibitory agents useful in the treatment methods described herein include inhibitor nucleic acid molecules that decrease the expression or activity of any of the microRNAs (eg, mature microRNA or precursor microRNA) listed in Tables 1 , 3, 5, 7, 9, 11, 12, 14, 16, or 18 (e.g., hsa-miR-155) or decrease the expression or activity of any of the mRNAs encoding an inflammatory marker listed in Table 21 (target mRNA).
[00204] [00204] Inhibitory nucleic acids useful in the present methods and compositions include antisense oligonucleotides, ribozymes, outer guide sequence (EGS) oligonucleotides, siR-
[00205] [00205] In some embodiments, the inhibitor nucleic acids are 10 to 50, 13 to 50, or 13 to 30 nucleotides in length. One skilled in the art will appreciate that this incorporates oligonucleotides that have antisense portions of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 50 nucleotides in length or any range within that. In some embodiments, oligonucleotides are 15 nucleotides in length. In some embodiments, the antisense or oligonucleotide compounds of the invention are 12 or 13 to 30 nucleotides in length. One skilled in the art will appreciate that this incorporates inhibitor nucleic acids that have antisense portions of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length or any range in between.
[00206] [00206] In some embodiments, the inhibitor nucleic acids are chimeric oligonucleotides that contain two or more chemically distinct regions, each composed of at least one nucleotide. These oligonucleotides typically contain at least one region of modified nucleotides that confer one or more beneficial properties (such as, for example, increased nuclease resistance, increased uptake into cells, increased binding affinity for the target) and a region which is a substrate for enzymes that can carry out the hybrid cleavage of RNA:DNA or RNA:RNA. The chimeric inhibitor nucleic acids of the invention may be formed as structures composed of two or more oligonucleotides, modified oligonucleotides, oligonucleotides, and/or oligonucleotide mimetics, as described above. Such compounds were also called in the prior art as hybrids or "gapmers". Representative U.S. patents showing the preparation of such hybrid structures include, but are not limited to, U.S. Patent Nos. 5,013,830, 5,149,797, 5,220,007,
[00207] [00207] In some embodiments, the inhibitor nucleic acid comprises at least one nucleotide modified at the 2' position of the sugar, most preferably a nucleotide modified by 2'-O-alkyl, 2'-O-alkyl- O-alkyl or 2'-fluoro. In other preferred embodiments, the RNA modifications include 2'-fluoro, 2'-amino, and 2'-O-methyl modifications to the ribose of the pyrimidines, abasic residues, or an inverted base at the 3' end of the RNA. Such modifications are routinely incorporated into oligonucleotides and these oligonucleotides have been shown to have a higher Tm (i.e., higher target binding affinity) than 2'-deoxyoligonucleotides against a given target.
[00208] [00208] A series of nucleotide and nucleoside modifications have been shown to render the oligonucleotide into which they are incorporated more resistant to nuclease digestion than the native oligodeoxynucleotide -- the modified oligos survive intact for a while. longer po than unmodified oligonucleotides.
[00209] [00209] Morpholino-based oligomeric compounds are described in Braasch et al., Biochemistry 41(14):4503-4510, 2002; Genesis, volume 30, issue 3, 2001; Heasman, J., Dev. Biol., 243:209-214, 2002; Nasevicius et al., Nat. Genet. 26: 216-220, 2000; Lacerra et al., Proc. natl. academy Sci. USA 97:9591-9596, 2000; and US Patent No. 5,034,506. Cyclohexenyl nucleic acid oligonucleotide mimetics is described in Wang et al., J. Am. Chem. social
[00210] [00210] Modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short-chain alkyl or cycloalkyl internucleoside bonds, mixed heteroatom and alkyl or cycloalkyl internucleoside bonds or bonds heteroatomic or heterocyclic internucleoside compounds of one or more short chains. These include those having morpholino linkages (formed partially from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl main chains; methyleneformacetyl and thioformacetyl backbones; alkene-containing backbones; main sulfamate chains; methyleneimino and methylenehydrazine backbones; sulfonate and sulfonamide backbones; amide backbones; and others that have N, O, S and CH2 component parts mixed in; see US Patent No. 5,034,506,
[00211] [00211] One or more substituted sugar moieties may also be included, for example one of the following at the 2' position: OH, SH, SCH3, F, OCN, OCH3 OCH3, OCH3 O(CH2)n CH3, O(CH2) n NH2 or O(CH2 )n CH3, where n is from 1 to about 10; C1 to C10 lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; Cl; BR; CN; CF3; OCF3; O-, S- or N-alkyl; O-, S- or N-alkenyl; SOCH3; SO2CH3; ONO2; NO2; N3; NH2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleavage group; a rapporteur group; an intercalator; a group for enhancing the pharmacokinetic properties of an oligonucleotide; or a group for enhancing the pharmacodynamic properties of an oligonucleotide and other substituents that have similar properties. A preferred modification includes 2'-methoxyethoxy [2'-O-CH 2 CH 2 OCH 3 , also known as 2'-O-(2-methoxyethyl)] (Martin et al., Helv. Chim. Acta 78:486, 1995). Other preferred modifications include 2'-methoxy (2'-O-CH3), 2'-propoxy (2'-OCH2CH2CH3) and 2'-fluoro (2'-F). Similar modifications can also be made at other positions in the oligonucleotide, in particular at the 3' position of the sugar on the 3' terminal nucleotide and at the 5' position of the 5' terminal nucleotide. Oligonucleotides may also have a sugar mimetic, such as cyclobutyls in place of the pentofuranosyl group.
[00212] [00212] Inhibitor nucleic acids may also include, in addition to
[00213] [00213] It is not necessary for all positions in a given oligonucleotide to be modified uniformly and, in fact, more than one of the aforementioned modifications can be incorporated into a single oligonucleotide or even within a single nucleoside within an oligonucleotide.
[00214] [00214] In some embodiments, a sugar bond and inter-
[00215] [00215] Inhibitory nucleic acids may also include one or more nucleobase modifications or substitutions (often referred to in the prior art simply as "base"). As used herein, "unmodified" or "natural" nucleobases comprise the purine bases adenine (A) and guanine (G) and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases, such as 5-methylcytosine (5-Me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of a. - denine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5 -halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-aza-adenine, 7-deazaguanine and 7-deaza-adenine and 3-deazaguanine and 3-deaza-adenine.
[00216] [00216] In addition, nucleobases comprise those described in US Patent No. 3,687,808, those described in 'The Concise Encyclopedia of Polymer Science and Engineering', p. 858-859, Kroschwitz, J.I., Ed. John Wiley & Sons, 1990, those described by Englisch et al., Angewandle Chemie, international edition, 1991, 30, p. 613 and those described by Sanghvi, Y.S., ch. 15, Antisense Research and Applications, p. 289-302, Crooke, S.T. and Lebleu, B.ea., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, comprising 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-Methylcytosine substitutions have been shown to increase the stability of two parts of the nucleic acid by 0.6-1.2<0>C (Sanghvi, YS, Crooke, ST and Lebleu, B., Eds, ' Antisense Research and Applications', CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications. Modified nucleobases are described in U.S. Patent No. 3,687,808, as well as 4,845,205, 5,130,302, 5,134,066,
[00217] [00217] In some embodiments, the inhibitor nucleic acids are chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. Such portions include, but are not limited to, lipid portions such as a cholesterol portion (Letsinger et al., Proc. Natl. Acad. Sci. USA 86:6553-6556, 1989), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett. 4:1053-1060, 1994), a thioether, for example, hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci. 660:306-309 , 1992; Manoharan et al., Bioorg. Med. Chem. Lett. 3:2765-2770, 1993), a thiocholesterol (Oberhauser et al., Nucl. Acids Res. 20, 533-538, 1992), an aliphatic chain , e.g. dodecandiol or hendecyl residues (Kabanov et al., FEBS Lett. 259:327-330, 1990; Svinarchuk et al., Biochimie 75:49-54, 1993), a phospholipid, e.g. dihexadecyl -rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett. 36:3651-3654, 1995; Shea et al., Nucl Acids Res. 18:3777-3783, 1990), a polyamine or a polyethylene glycol chain (Mancharan et al., Nucleosides & Nucleotides 14:969-973, 1995) or adamantane acetic acid (Manoharan et al., Tetrahedron Lett. 36:3651-3654, 1995), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta 1264: 229-237, 1995) or an octadecylamine or hexylamino-carbonyl-toxycholesterol moiety (Crooke et al. ., J. Pharmacol. Exp. Ther. 277:923-937, 1996). See also US Patent Nos.
[00218] [00218] These moieties or conjugates may include the conjugated groups covalently linked to functional groups such as primary or secondary hydroxyl groups. Conjugated groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugated groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins and dyes. Groups that enhance pharmacodynamic properties, in the context of the present invention, include groups that enhance uptake, enhance resistance to degradation, and/or enhance sequence-specific hybridization to the target nucleic acid. Groups that enhance pharmacokinetic properties, in the context of the present invention, include groups that enhance uptake, distribution, metabolism or excretion of the compounds of the present invention. Representative conjugate groups are described in International Patent Application No. PCT/US92/09196, filed October 23, 1992 and U.S. Patent No. 6,287,860, which are incorporated herein by reference. Conjugated moieties include, but are not limited to, lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-5-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or hendecyl residues. , a phospholipid, for example dihexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or polyethylene glycol chain or acetic acid of adamantane, a palmityl moiety or an octadecylamine or hexylamino-hexylamino-
[00219] [00219] Inhibitory nucleic acids useful in the present methods are sufficiently complementary to the target miRNA, i.e., hybridize well enough and with sufficient specificity, to impart the desired effect. "Complementary" refers to the ability to pair, through hydrogen bonding, between two sequences that comprise naturally occurring or non-naturally occurring bases or analogs thereof. For example, if a base at one position on an inhibitor nucleic acid can bind hydrogen with a base at the corresponding position on a miRNA, then the bases are considered complementary to each other at that position. In some embodiments, 100% complementarity is not required. In some modalities, 100% complementarity is required. Routine methods can be used to design an inhibitory nucleic acid that binds to the target sequence with sufficient specificity.
[00220] [00220] While the specific sequences of certain exemplifying target segments have been determined in the present invention, one skilled in the art will recognize that they serve to illustrate and describe particular embodiments within the scope of the present invention. Additional target segments are readily identifiable by one skilled in the art in view of this description. Target segments 5, 6, 7, 8, 9, 10 or more nucleotides in length that comprise a stretch of at least five (5) consecutive nucleotides within or immediately adjacent to the seed sequence are also considered appropriate for the targeting. In some embodiments, target segments may include sequences that comprise at least the 5'-terminus consecutive 5'-terminus of one of the seed sequence (the remaining nucleotides are a consecutive stretch of the same RNA that begins immediately upstream of the 5'-end). termination of the seed sequence and continues until the inhibitor nucleic acid contains about 5 to about 30 nucleotides). In some embodiments, the target segments are represented by RNA sequences that comprise at least the 5 consecutive nucleotides from the 3'-terminus of one of the seed sequences (the remaining nucleotides are a consecutive stretch of the same miRNA that begins immediately downstream of the seed sequence). 3'-terminus of the target segment and continues until the inhibitor nucleic acid contains about 5 to about 30 nucleotides). One skilled in the art with the sequences provided herein could, without undue experimentation, identify additionally preferred regions for targeting. In some embodiments, an inhibitor nucleic acid contains a sequence that is complementary to at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 , 20, 21, 22, 23, 24 or 25 contiguous nucleotides present in the target (e.g. the target miRNA, e.g. mature or precursor hsa-miR-155, or the target mRNA).
[00221] [00221] Once one or more target regions, segments or sites have been identified, compounds of the inhibitor nucleic acid are chosen which are sufficiently complementary to the target, i.e. hybridize well enough and with sufficient specificity (i.e. , do not substantially bind to other non-target RNAs) to confer the desired effect.
[00222] [00222] In the context of the present invention, "hybridization" means the hydrogen bond, which may be the Watson-Crick, Hoogsteen or inverted Hoogsteen hydrogen bond, between the complementary bases of the nucleoside or nucleotide. For example, adenine and thymine are complementary nucleobases that pair through hydrogen bond formation. "Complementary", as used herein, refers to the ability to pair precisely between two nucleotides. For example, if a nucleotide at a certain position on an oligonucleotide can bind hydrogen with a nucleotide at the same position on a miRNA molecule or an mRNA molecule, then the inhibitor nucleic acid and the miRNA or mRNA are considered complementary to each other in that position. Inhibitor nucleic acids and miRNA or mRNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides that can hydrogen-bond to each other. Thus, "specifically hybridizable" and "complementary" are terms that are used to indicate a sufficient degree of complementarity or precise matching such that stable and specific binding occurs between the inhibitor nucleic acid and the miRNA target. For example, if a base at one position on an inhibitor nucleic acid can hydrogen bond with a base at the corresponding position on a miRNA or mRNA, the bases are then considered complementary to each other at that position. 100% complementarity is not required.
[00223] [00223] It should be understood in the prior art that a complementary nucleic acid sequence need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable.
[00224] [00224] For most applications, the wash steps that follow hybridization will also vary in stringency. Wash stringency conditions can be defined by salt concentration and temperature. As above, the washing stringency can be increased by decreasing the salt concentration or increasing the temperature. For example, the strict salt concentration for the washing steps will preferably be less than about 30 mM NaCl and 3 mM trisodium citrate, and most preferably less than about mM NaCl and 1.5 mM trisodium citrate. Stringent temperature conditions for the washing steps will commonly include a temperature of at least about 25°C, with more reference to at least about 42°C, and most preferably of at least about 42°C. of 68°C. In a preferred embodiment, the washing steps will take place at 25°C in 30 mM NaCl, 3 mM trisodium citrate and 0.1% SDS. In a preferred embodiment, the washing steps will take place at 42°C in 15 mM NaCl, 1.5 mM trisodium citrate and 0.1% SDS. In a preferred embodiment, the washing steps will take place at 68°C in 15 mM NaCl, 1.5 mM trisodium citrate and 0.1% SDS. Additional variations in these conditions will be readily apparent to those skilled in the art. Hybridization techniques are well known to those skilled in the art and are described, for example, in Benton and Davis (Science 196:180, 1977); Grunstein and Hogness (Proc. Natl. Acad. Sci. USA 72:3961, 1975); Ausubel et al. (Current Protocols in Molecular Biology, Wiley Interscience, New York, 2001); Berger and Kimmel (Guide to Molecular Cloning Techniques, 1987, Academic Press, New York); and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York.
[00225] [00225] In general, inhibitor nucleic acids useful in the methods described herein have a sequence complementarity of at least 80% to a region within the target nucleic acid, for example, 90%, 95%, or 100% complementarity of the target nucleic acid. sequence to the target region within a miRNA. For example, an antisense compound in which 18 of the 20 nucleobases of the antisense oligonucleotide are complementary and therefore would be specifically hybridized to a target region, would represent 90% of complementarity. The percentage of complementarity of an inhibitor nucleic acid with a region of a target nucleic acid can be determined routinely using basic local alignment search tools (BLAST programs) (Altschul et al., J. Mol. Biol. 215:403- 410, 1990; Zhang and Madden, Genome Res. 7:649-656, 1997). Antisense compounds and other compounds of the invention that hybridize to a miRNA or mRNA are identified through routine experimentation. In general, inhibitor nucleic acids must retain specificity for their target, that is, they must not significantly bind to or directly affect the expression levels of transcripts other than the intended target.
[00226] [00226] For a further description regarding inhibitory nucleic acids, see Patent Applications: US2010/0317718 (antisense oligos); US2010/0249052 (double stranded ribonucleic acid
[00227] [00227] Antisense oligonucleotides are typically designed to block the expression of a DNA or RNA target by binding to the target and disrupting expression at the transcriptional, translational or docking level. The antisense oligonucleotides of the present invention are complementary nucleic acid sequences designed to hybridize under stringent conditions to either the target microRNA or the target inflammatory marker mRNA. In this way, oligonucleotides are chosen that are sufficiently complementary to the target, i.e., that hybridize well enough and with sufficient specificity, to confer the desired effect. Modified Bases/Locked Nucleic Acids (LNAs)
[00228] [00228] In some embodiments, the inhibitory nucleic acids used in the methods described herein comprise one or more modified bonds or bases. Modified bases include phosphorothioate, methylphosphonate, peptide nucleic acids or locked nucleic acid (LNA) molecules. Preferably, the modified nucleotides are locked nucleic acid molecules, including [alpha]-L-LNAs. LNAs comprise ribonucleic acid analogues in which the ribose ring is "locked" by a methylene bridge between the 2'-oxygen and the 4'-carbon, i.e. oligonucleotides containing at least one LNA monomer, i.e. a 2'-O,4'-C-methylene-D-ribofuranosyl nucleotide. LNA bases form Watson-Crick base pairs, but the locked configuration increases the rate and stability of the base pairing reaction (Jepsen et al., Oligonucleotides 14:130-146, 2004). LNAs also have increased base pair affinity for RNA compared to DNA. These properties result
[00229] [00229] LNA molecules may include molecules comprising 10-30, e.g. 12-24, e.g. 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 , 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in each strand, where one of the strands is substantially identical, e.g. at least 80% (or more, e.g. 85%, 90%, 95% or 100%) identical, eg having 3, 2, 1 or 0 incompatible nucleotide(s), to a target region on the miRNA or mRNA. LNA molecules can be chemically synthesized using methods known in the art.
[00230] [00230] LNA molecules can be designed using any method known in the state of the art; a number of algorithms are known and commercially available (eg on the internet, eg at exiqon.com). See, for example, You et al., Nuc. Acids Res. 34:e60, 2006; McTigue et al., Biochemistry 43:5388-405, 2004; and Levin et al., Nuc. Acids Res. 34:e142, 2006. For example, gene walk methods, similar to those used to design antisense oligos, can be used to optimize LNA inhibitory activity; for example, a series of oligonucleotides of 10-30 nucleotides spanning the length of a target miRNA or mRNA can be prepared, followed by testing for activity. Optionally, spacings of, for example, 5-10 nucleotides or more can be left between the LNAs to reduce the number of oligonucleotides synthesized and tested. The GC content is preferably between about 30-60%. The guidelines for designing LNAs are known in the prior art; For example, sequences of
[00231] [00231] In some embodiments, LNA molecules can be designed to target a specific region of the miRNA. For example, a specific functional region may be targeted, for example a region comprising a seed sequence. Alternatively or in addition, highly conserved regions can be targeted, e.g. regions identified by aligning sequences from distinct species such as primates (e.g. humans) and rodents (e.g. mice) and looking for regions with degrees highs of identity. Percent identity can be routinely determined using basic alignment search tools (BLAST programs) (Altschul et al., J. Mol. Biol. 215:403-410, 1990; Zhang and Madden, Genome Res. 7 :649-656, 1997), for example, using the default parameters.
[00232] [00232] For additional information regarding LNAs, see US Patent No. 6,268,490, 6,734,291, 6,770,748,
[00233] [00233] See also USSN Patent Application 61/412,862, which is incorporated herein by reference in its entirety. antagomirs
[00234] [00234] In some embodiments, the antisense is an antagomir. Antagomirs are chemically modified antisense oligonucleotides that target a microRNA (eg, hsa-miR-155 target). For example, an antagomir for use in the methods described herein may include a nucleotide sequence sufficiently complementary to hybridize a miRNA target sequence of about 12 to 25 nucleotides, preferably about 15 to 23 nucleotides.
[00235] [00235] In general, antagomirs include a cholesterol moiety, for example at the 3' end. In some embodiments, antagomirs have various modifications for rNase protection and pharmacological properties such as enhanced tissue and cellular uptake. For example, in addition to the modifications discussed above for antisense oligos, an antagomir may have one or more of the complete or partial 2'-O-methylation of the sugar and/or of a phosphorothioate backbone. Phosphorothioate modifications offer protection against rNase activity and its lipophilicity contributes to enhanced tissue uptake. In some embodiments, antagomir may include six phosphorothioate backbone modifications; two phosphorothioates are found at the 5' end and four at the 3' end. See, for example, Krutzfeldt et al., Nature 438:685-689, 2005 ; Czech, N. Engl. J. Med. 354:1194-1195, 2006 ; Robertson et al., Silence 1:10, 2010; Marquez and McCaffrey, Human Gene Ther. 19(1):27–38, 2008; van Rooij et al., Circ. Res. 103(9):919–928, 2008 and Liu et al., Int. J. Mol. Sci. 9:978-999, 2008.
[00236] [00236] Antagomirs useful in the present methods can also be modified with respect to their length or else the number of nucleotides that make up the antagomir. In general, antagomirs are about 20-21 nucleotides long for the function.
[00237] [00237] In some embodiments, the inhibitor nucleic acid is locked and includes a cholesterol moiety (eg, a locked antagomir). siRNA
[00238] [00238] In some embodiments, the nucleic acid sequence that is complementary to a target miRNA or target mRNA may be an interfering RNA, including, but not limited to, a small interfering RNA ("siRNA") or an interfering RNA small hairpin ("shRNA") type. Methods for constructing the interference RNAs are well known in the art. For example, interfering RNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, where the sense and antisense strands are self-complementary (that is, each strand comprises the nucleotide sequence that is complementary to the nucleotide sequence on the other strand; such as where the sense and antisense strands form a two-part or double stranded structure); the antisense strand comprises the nucleotide sequence which is complementary to a nucleotide sequence in a target nucleic acid molecule or a portion thereof (i.e. an unwanted gene) and the sense strand comprises the nucleotide sequence which corresponds to the target nucleic acid sequence or a portion thereof. Alternatively, the interfering RNA is assembled from a single oligonucleotide, where the self-complementary sense and antisense regions are linked via the nucleic acid or non-nucleic acid-based binder(s). The interfering RNA can be a polynucleotide with a two-part, two-part, asymmetrical, hairpin-like structure or asymmetrical hairpin-like secondary structure, having self-complementary sense and antisense regions, where the antisense region comprises a nucleotide sequence that is complementary to the nucleotide sequence in a separate target nucleic acid molecule or a portion thereof, and the sense region has the nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The interference may be a single-stranded circular polynucleotide that has two or more loop structures and a stem that comprises the sense and antisense self-complementary regions, wherein the antisense region comprises the nucleotide sequence that is complementary to the nucleotide sequence. in a target nucleic acid molecule or a portion thereof and the sense region has the nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof and wherein the circular polynucleotide can be processed in vivo or in vitro to generate an active siRNA molecule that can mediate RNA interference.
[00239] [00239] In some embodiments, the coding region of the interference RNA encodes a self-complementary RNA molecule that has a sense region, an antisense region, and a loop region. Such an RNA molecule, when desirably expressed, forms a "hairpin-like" structure and is termed "shRNA" herein. The loop region is generally between about 2 and about 10 nucleotides in length. In some embodiments, the loop region is from about 6 to about 9 nucleotides in length. In some embodiments, the sense region and antisense region are between about 15 and about 20 nucleotides in length. After post-transcriptional processing, the small hairpin-like RNA is converted into a siRNA by a cleavage event mediated by the enzyme Dicer, which is a member of the rNase III family. The siRNA can then inhibit the expression of a gene with which it shares homology. For details, see Brummelkamp et al., Science 296:550-553, 2002; Lee et al., Nature Biotechnol., 20, 500-505, 2002 ; Miyagishi and Taira, Nature Biotechnol. 20:497-500, 2002; Paddison et al., Genes & Dev. 16:948-958, 2002; Paul, Nature Biotechn.. 20, 505-508, 2002; Sui, Proc. natl. academy Sci. USA, 99(6):5515-5520, 2002; Yu et al., Proc. natl. academy Sci. USA 99:6047-6052, 2002.
[00240] [00240] The siRNA-guided target RNA cleavage reaction is highly sequence-specific. In general, siRNA that contains a nucleotide sequence identical to a portion of the target nucleic acid (i.e., a target region that comprises the seed sequence of a miRNA or target mRNA) is preferred for inhibition. However, 100% sequence identity between the siRNA and the target gene is not required to practice the present invention. Thus, the invention has the advantage of tolerating sequence variations that might be expected due to genetic mutation, strain polymorphism or evolutionary divergence. For example, siRNA sequences with insertions, deletions, and single-point mutations relative to the target sequence have also been found to be effective for inhibition. Alternatively, siRNA sequences with analogous nucleotide substitutions or insertions may be effective for inhibition. In general, siRNAs must retain specificity for their target, that is, they must not significantly bind to or directly affect transcript expression levels, with the exception of the intended target. ribozymes
[00241] [00241] Trans-cleaving enzymatic nucleic acid molecules may also be used; have shown promise as therapeutic agents for human diseases (Usman & McSwiggen, Ann. Rep. Med. Chem. 30:285-294, 1995; Christoffersen and Marr, J. Med. Chem. 38:2023-2037, 1995) . Enzymatic nucleic acid molecules can be designed to cleave specific miRNA or mRNA targets within the cellular RNA base. Such a cleavage event results in non-functional miRNA or mRNA.
[00242] [00242] In general, enzymatic nucleic acids with RNA-cleaving activity act primarily by binding to a target RNA. Such binding occurs through the target-binding portion of an enzymatic nucleic acid that is held in close proximity to an enzymatic portion of the molecule that acts to cleave the target RNA. In this way, the enzymatic nucleic acid first recognizes and then binds to a target RNA through complementary base pairing and, once bound to the correct site, acts enzymatically to cut the target RNA. Strategic cleavage of such a target RNA will destroy its activity. After an enzymatic nucleic acid has bound and cleaved its target from the RNA, it is freed from that RNA to seek out another target, and can repeatedly bind and cleave new targets.
[00243] [00243] Several approaches such as in vitro selection (developmental) strategies (Orgel, Proc. R. Soc. London, B 205:435, 1979) have been used to develop novel nucleic acid catalysts that can catalyze a variety of of reactions such as the cleavage and attachment of phosphodiester bonds and amide bonds ( Joyce, Gene, 82, 83-87, 1989; Beaudry et al., Science 257, 635-641, 1992; Joyce, Scientific American 267 , 90-97, 1992; Breaker et al., TIBTECH 12:268, 1994; Bartel et al., Science 261:1411-1418, 1993; Szostak, TIBS 17, 89-93, 1993; Kumar et al., FASEB J., 9:1183, 1995; Breaker, Curr. Op. Biotech., 1:442, 1996). The development of ribozymes that are ideal for catalytic activity would contribute significantly to any strategy that employs RNA-cleaving ribozymes to regulate gene expression. Hammerhead ribozyme, for example, functions with a catalytic rate (kcat) of about 1 min-1 in the presence of saturating concentrations (10 mM) of the Mg2+ cofactor. An artificial "RNA ligase" ribozyme has been shown to catalyze the corresponding self-modification reaction at a rate of about 100 min-1. Furthermore, certain modified hammerhead-like ribozymes that have substrate-binding arms made from DNA are known to catalyze RNA cleavage with multiple turn-over rates approaching 100 min-1. Sense Nucleic Acids
[00244] [00244] Agents useful in the treatment methods described herein include sense nucleic acid molecules that increase the expression or activity of any of the microRNAs (eg, mature microRNA or precursor microRNA) listed in Tables 2 , 4, 6, 8, 10, 13, 15, 17 and 19 or increase the expression or activity of any of the mRNAs encoding an inflammatory marker listed in Table 21. A sense nucleic acid may contain a sequence that is at least 80% (e.g., at least 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to the sequence of any of the microRNAs (e.g., mature or mi- precursor croRNA) listed in Tables 2, 4, 6, 8, 10, 13, 15, 17 and 19 or the sequence of any of the mRNAs listed in Table 21. Sense nucleic acids may contain one or more of any of these of the modifications (e.g., backbone modifications, nucleobase modifications, sugar modifications, or one or more conjugated molecules) described herein, without limitation. Methods of producing and administering sense nucleic acids are known in the art. Additional methods of producing and using the sense nucleic acids are described herein.
[00245] [00245] The nucleic acid sequences used in the practice of the methods described herein, whether from RNA, DNA, genomic DNA, vectors, viruses or hybrids thereof, can be isolated from a variety of sources, genetically engineered, amplified, and /or expressed/recombinantly generated. Recombinant nucleic acid sequences can be individually isolated or cloned and tested for desired activity. Any recombinant expression system can be used, including, for example, in vitro cellular, bacterial, fungal, mammalian, yeast, insect, or plant expression systems.
[00246] [00246] The nucleic acid sequences of the invention (e.g., any of the inhibitor nucleic acids or sense nucleic acids described herein) can be introduced into delivery vectors and be expressed from the transcriptional units within the vectors. . Recombinant vectors can be DNA plasmids or viral vectors. Generation of the vector construct can be performed using any appropriate genetic engineering technique well known in the art, including, without limitation, standard PCR techniques, oligonucleotide synthesis, restriction endonuclease digestion, ligation, transformation, plasmid purification and DNA sequencing, for example, as described in Sambrook et al. Molecular Cloning: A Laboratory Manual (1989)), Coffin et al. (Retroviruses (1997)) and "RNA Viruses: A Practical Approach" (Alan J. Cann, Ed., Oxford University Press, (2000)).
[00247] [00247] As will be apparent to one skilled in the art, a variety of suitable vectors are available for delivering nucleic acids of the invention into cells. The selection of an appropriate vector to deliver the nucleic acids and the optimization of conditions for the insertion of the selected expression vector into the cell are within the scope of one skilled in the art, without the need for undue experimentation. Viral vectors comprise a nucleotide sequence that has sequences for producing recombinant viruses in an enveloping cell. Viral vectors expressing the nucleic acids of the invention can be constructed based on the viral backbone including, but not limited to, a retrovirus, lentivirus, herpes virus, adenovirus, adeno-associated virus, smallpox virus or a alphavirus. Recombinant vectors (e.g., viral vectors) that can express the nucleic acids of the invention can be applied, as described herein, and persist in target cells (e.g., stable transformants). For example, such recombinant vectors (e.g., a recombinant vector that results in the expression of an antisense oligomer that is complementary to hsa-miR-155) can be administered (e.g., by injection or infusion) into the cerebrospinal fluid of the patient. individual (eg, intracranial injection, intraparenchymal injection, intraventricular injection, and intrathecal injection. See, for example, Bergen et al., Pharmaceutical Res. 25:983-998, 2007). A series of exemplary recombinant viral vectors that can be used to express any of the nucleic acids described herein are also described in Bergen et al. (supra). Additional examples of recombinant viral vectors are known in the prior art.
[00248] [00248] The nucleic acids provided herein (e.g. inhibitor nucleic acids) may be further complexed with one or more cationic polymers (e.g. poly-L-lysine and poly(ethyleneimine), cationic lipids (e.g. 1,2-dioleoyl-3-trimethylammonium propone (DOTAP), N-methyl-4-(dioleyl)methylpyridinium and 3-[N-(N',N'-dimethylaminoethane)-carbamoyl]cholesterol) and/or nanoparticles (eg For example, cationic polybutylcyanoacrylate nanoparticles, na-
[00249] [00249] In some embodiments, inhibitor nucleic acids (e.g., one or more inhibitor nucleic acids that target hsamiR-155) can be administered systemically (e.g., intravenously, intra-arterially, intramuscularly, subcutaneously or intraperitoneally) or intrathecally (e.g. via epidural administration). In some embodiments, the inhibitor nucleic acid is administered in a composition (e.g., complexed with) one or more cationic lipids. Non-limiting examples of cationic lipids that can be used in the delivery of one or more inhibitor nucleic acids (e.g., any of the inhibitor nucleic acids described herein) include: lipofectamine, the cationic lipid molecules described in the Patent Application WO 97/045069 and in US Patent Application Publications No. 2012/0021044, 2012/0015865, 2011/0305769, 2011/0262527, 2011/0229581, 2010/0305198, 2010/0203112 and 2010/0104629 (each incorporated herein by reference). Nucleic acid sequences used in the practice of the present invention can be synthesized in vitro using well-known chemical synthesis techniques, as described, for example, in Adams, J. Am. Chem.
[00250] [00250] The nucleic acid sequences of the invention can be stabilized against nucleolytic degradation such as by incorporation of a modification, for example a nucleotide modification. For example, the nucleic acid sequences of the invention include a phosphorothioate at least in the first, second or third internucleotide linkage at the 5' or 3' end of the nucleotide sequence. As another example, the nucleic acid sequence may include a 2'-modified nucleotide, for example, a 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O -DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE) or 2'-O--N-methylacetamido (2'-O--NMA). As another example, the nucleic acid sequence may include at least one 2'-O-methyl-modified nucleotide and, in some embodiments, all nucleotides include a 2'-O-methyl modification. In some embodiments, the nucleic acids are "locked", that is, they comprise nucleic acid analogues in which the ribose ring is "locked" by a methylene bridge connecting the 2'-O atom and the 4' atom. -C (see, for example, Kaupinnen et al., Drug Disc. Today 2(3):287-290, 2005; Koshkin et al., J. Am. Chem. Soc., 120(50):13252 –13253, 1998). For further modifications, see Patent Applications No. 2010/0004320, 2009/0298916 and 2009/0143326 (each incorporated herein by reference).
[00251] [00251] Techniques for manipulating nucleic acids used in the practice of the present invention, such as, for example, subcloning
[00252] [00252] One or more antibodies that specifically bind to a protein encoded by any of the inflammatory marker genes listed in Table 21 may also be administered to an individual to treat a neurodegenerative disease. Antibodies that specifically bind a protein listed in Table 21 are commercially available or can be generated using standard methods known in the art. For example, a polyclonal antibody that specifically binds to a protein listed in Table 21 can be generated by immunizing a mammal with the purified protein and isolating antibodies from the mammal that specifically bind to the purified protein. The antibodies used can be a monoclonal or a polyclonal antibody. The administered antibodies can be an immunoglobulin G or immunoglobulin M. The administered antibodies can be chimeric (eg, a humanized antibody) or a human antibody. Antibodies used may also be an antibody fragment (e.g. Fab, F(ab')2, Fv and single chain Fv fragment (scFv)).
[00253] [00253] One or more inflammatory marker proteins listed in Table 20 may also be administered to a subject for the treatment of a neurodegenerative disorder. Several methods are known in the prior art for producing a recombinant protein using molecular biology and cell culture techniques. For example, an inflammatory marker protein encoded by an mRNA sequence listed in Table 20 can be transfected into a bacterial, yeast, or mammalian cell (using a protein expression plasmid or a viral vector) that allows for expression. of the inflammatory marker by the transfected cell. The transfected cells or the culture medium can be harvested, and the recombinant inflammatory marker protein is purified using methods known in the art. Inflammatory marker proteins administered to the subject may contain a sequence that has at least 80% identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) to any of the amino acid sequences listed in Table 20. Inflammatory marker proteins administered to the subject may additionally contain a modification (e.g., a polyethylene glycol or an HIV tat protein or any other moiety that increases the cellular permeability of the inflammatory marker protein). Pharmaceutical Compositions
[00254] [00254] The methods described herein may include administering pharmaceutical compositions and formulations comprising one or more (e.g., two, three, four, or five) of the inhibitor nucleic acids (e.g., one or more inhibitor nucleic acids). that target hsa-miR-155), sense nucleic acids, inflammatory marker proteins, or antibodies described herein.
[00255] [00255] In some embodiments, the compositions are formulated with a pharmaceutically acceptable carrier. Pharmaceutical compositions and formulations can be administered parenterally, topically, orally, or by local administration, such as by aerosol or transdermally. The compositions may be formulated in any manner and may be administered in a variety of unit dosage forms, depending upon the condition or disease and the degree of the disease, the general medical condition of each patient, the resulting preferred method of administration, and so on. . Details on techniques for the formulation and administration of pharmaceutical compounds are well described in the scientific and patent literature. See, for example, Remington: The Science and Practice of Pharmacy, 21st ed., 2005.
[00256] [00256] Inhibitor nucleic acids can be administered alone or as a component of a pharmaceutical formulation (composition). The compounds may be formulated for administration in any manner convenient for use in human or veterinary medicine. Wetting, emulsifying and lubricating agents such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, releasing agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants may also be present in the compositions. In one embodiment, one or more cationic lipids, cationic polymers, or nanoparticles can be included in compositions containing one or more inhibitor nucleic acids (e.g., compositions that contain one or more inhibitor nucleic acids that target hsa-miR- 155).
[00257] [00257] Formulations of the compositions of the invention include those suitable for intradermal, inhalation, oral/nasal, topical, parenteral, rectal and/or intravaginal administration. The formulations may conveniently be presented in dosage form.
[00258] [00258] The pharmaceutical formulations of the present invention may be prepared according to any method known in the art for producing the pharmaceuticals. Such drugs may contain sweetening agents, flavoring agents, coloring agents, and preserving agents. A formulation can be mixed with non-toxic pharmaceutically acceptable excipients that are suitable for production. The formulations may comprise one or more diluents, emulsifiers, preservatives, buffers, excipients etc. and may be provided in forms such as liquids, powders, emulsions, lyophilized powders, sprays, creams, lotions, controlled release formulations, tablets, pills, gels, patches, implants, etc.
[00259] [00259] Pharmaceutical formulations for oral administration may be formulated using pharmaceutically acceptable carriers well known in the art in appropriate and suitable dosages. Such carriers allow pharmaceuticals to be formulated in unit dosage form as tablets, pills, powders, dragees, capsules, liquids, lozenges, gels, syrups, pastes, suspensions, etc., suitable for ingestion. by the patient. Pharmaceutical preparations for oral use may be formulated as a solid excipient, optionally by grinding a mixture.
[00260] [00260] Aqueous suspensions may contain an active agent (e.g. inhibitory nucleic acids or sense nucleic acids described herein) in admixture with appropriate excipients for the production of aqueous suspensions, e.g. for aqueous intradermal injections. . Such excipients include a suspending agent, such as sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia, and dispersing or wetting agents such as a natural phosphatide (e.g., lecithin). , a product of the condensation of an alkylene oxide with a fatty acid (e.g., polyoxyethylene stearate), a product of the condensation of ethylene oxide with a long-chain aliphatic alcohol (e.g., heptadecaethyl- leno-oxycetanol), a condensation product of ethylene oxide with a partial ester derived from a fatty acid and a hexitol (e.g. polyoxyethylene sorbitol monooleate) or a condensation product of ethylene oxide with a fatty acid derived partial ester and a hexitol anhydride (e.g. polyoxyethylene sorbitan monooleate). The aqueous suspension may also contain one or more preservatives such as ethyl or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents and one or more sweetening agents, such as sucrose, aspartame or saccharin. Formulations can be adjusted for osmolarity.
[00261] [00261] In some embodiments, oil-based pharmaceuticals are used for the delivery of the nucleic acid sequences of the invention. Oil-based suspensions can be formulated by suspending an active agent in a vegetable oil, such as peanut oil, olive oil, sesame oil, or coconut oil, or in a mineral oil such as liquid paraffin; or a mixture of these. See for example US Patent No. 5,716,928, which describes the use of essential oils or essential oil components to increase the bioavailability and reduce inter- and intra-individual variability of orally administered hydrophobic pharmaceutical compounds (see also U.S. Patent No.
[00262] [00262] Pharmaceutical formulations can also be in the form of oil-in-water emulsions. The oily phase may be a vegetable oil or a mineral oil, described above, or a mixture thereof. Suitable emulsifying agents include natural gums such as gum acacia and gum tragacanth, natural phosphatides such as soy lecithin, esters or partial esters derived from fatty acids and hexitol anhydrides such as mono-oleate. of sorbitan and the condensation products of these partial esters with ethylene oxide, such as polyoxyethylene sorbitan monooleate. The emulsion may also contain sweetening agents and flavoring agents, as in the formulation of syrups and elixirs. Such formulations may also contain an emollient, preservative or coloring agent. In alternative embodiments, these injectable oil-in-water emulsions of the invention comprise a paraffin oil, a sorbitan monooleate, an ethoxylated sorbitan monooleate and/or an ethoxylated sorbitan trioleate.
[00263] [00263] Pharmaceutical compounds can also be administered intranasally, intraocularly and intravaginally, including suppositories, insufflations, powders and aerosol formulations (as examples of steroid inhalants, see for example Rohatagi, J. Clin. Pharmacol 35:1187-1193, 1995; Tjwa, Ann. Allergy Asthma Immunol. 75:107-111, 1995). Suppository formulations can be prepared by mixing the drug with a suitable non-irritating excipient that is solid at ordinary temperatures but liquid at body temperatures and therefore melts in the body to release the drug. Such materials are cocoa butter and polyethylene glycols.
[00264] [00264] In some embodiments, pharmaceutical compounds may be applied transdermally, topically, formulated as applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, jellies, tinctures, powders, and aerosols.
[00265] [00265] In some embodiments, pharmaceutical compounds may also be applied as microspheres for slow release into the body. For example, microspheres can be administered by intradermal injection of the drug that is slowly released subcutaneously; see Rao, J. Biomater Sci. Polym. Ed. 7:623-645, 1995; as biodegradable and injectable gel formulations, see, for example, Gao, Pharm. Res. 12:857-863, 1995; or, as microspheres for oral administration, see, for example, Eyles, J. Pharm. Pharmacol. 49:669-674, 1997.
[00266] [00266] In some embodiments, pharmaceutical compounds may be administered parenterally, such as by intravenous (iv) administration or administration into a body cavity, an organ lumen, or the skull (e.g., injection or infusion). intracranial) or in the cerebrospinal fluid of an individual. These formulations may comprise a solution of the active agent dissolved in a pharmaceutically acceptable carrier. Acceptable vehicles and solvents that can be used are water and Ringer's solution, an isotonic sodium chloride. In addition, sterile, fixed oils can be used as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed, including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can also be used in the preparation of injectables. These solutions are sterile and generally free of unwanted matter. These formulations can be sterilized using conventional and well known sterilization techniques. The formulations may contain pharmaceutically acceptable auxiliary substances, as necessary, to approximate physiological conditions, such as pH adjusting and buffering agents, toxicity adjusting agents, e.g. sodium acetate, chloride sodium chloride, potassium chloride, calcium chloride, sodium lactate and others. The concentration of active agent in these formulations can vary widely and will be selected primarily on the basis of fluid volumes, viscosities, body weight and the like, in accordance with the particular mode of administration selected and the needs of the patient. For iv administration, the formulation may be a sterile injectable preparation, such as a sterile injectable aqueous or oleaginous suspension. This suspension may be formulated using the appropriate dispersing agents or wetting and suspending agents. The sterile injectable preparation may also be a suspension in a non-toxic diluent or parenterally acceptable solvent, such as a solution of 1,3-butanediol. Administration may be by bolus or by continuous infusion (eg, substantially uninterrupted introduction into a blood vessel for a specified period of time).
[00267] [00267] In some embodiments, the compounds and pharmaceutical formulations may be lyophilized. Stable lyophilized formulations comprising an inhibitory nucleic acid or a sense nucleic acid can be made by lyophilizing a solution comprising a pharmaceutical of the invention and a blowing agent, for example, mannitol, trehalose, raffinose and sucrose or mixtures thereof. A process for preparing a stable lyophilized formulation may include lyophilizing a solution of about 2.5 mg/ml protein, about 15 mg/ml sucrose, about 19 mg/ml NaCl, and a citrate buffer. of sodium that has a pH of more than 5.5 but less than 6.5. See, for example, Patent Application US2004/0028670.
[00268] [00268] The compositions and formulations can be applied by the use of liposomes. By using liposomes, in particular where the surface of the liposome carries specific ligands to the target cells or are preferentially targeted to a specific organ, one can aim to apply the active agent to the target cells in vivo. See, for example, US Patent Nos. 6,063,400;
[00269] [00269] The formulations of the invention can be administered for prophylactic and/or therapeutic treatments. In some embodiments, for therapeutic applications, the compositions are administered to a subject who is at risk for or has a disorder described herein, in an amount sufficient to cure, alleviate, or partially arrest the clinical manifestations of the disorder or its complications; this may be called a therapeutically effective amount. For example, in some embodiments, the pharmaceutical compositions of the invention are administered in an amount sufficient to reduce the number of symptoms or reduce the severity, duration, or frequency of one or more symptoms of a neurodegenerative disorder in a subject.
[00270] [00270] The amount of the pharmaceutical composition suitable to accomplish this is a therapeutically effective dose. The dosage schedule and effective amounts for this use, i.e., the dosage regimen, will depend on a variety of factors, including the stage of the disease or condition, the severity of the disease or condition, the the patient's general health status, the patient's physical status, age, and more. When calculating the dosing regimen for a patient, the mode of administration is also taken into account.
[00271] [00271] The dosing regimen also takes into account pharmacokinetic parameters well known in the prior art, i.e. absorption rate of active agents, bioavailability, metabolism, clearance and others still (see, for example, Hidalgo - Aragones, J. Steroid Biochem. Mol. Biol. 58:611-617, 1996; Groning, Pharmazie 51:337-341, 1996; Fotherby, Contraception 54:59-69, 1996; Johnson, J. Pharm. Sci. 84:1144-1146, 1995; Rohatagi, Pharmazie 50:610-613, 1995; Brophy, Eur. J. Clin. Pharmacol. 24:103-108, 1983; Remington: The Science and Practice of Pharmacy, 21st ed., 2005). The state of the art allows the clinician to determine the dosing regimen for each individual patient, the active agent and the disease or condition treated. The guidelines provided for similar compositions used as pharmaceuticals can be used as a guide to determine the dosage regimen, i.e., the dose schedule and dosage levels, administered when practicing the methods of the invention, which are correct. and appropriate.
[00272] [00272] Single or multiple administrations of the formulations may be given depending on, for example: the dosage and frequency tolerated by the patient, as needed, and others still. The formulations must provide a sufficient amount of the active agent for the effective treatment, prevention or amelioration of conditions, diseases or symptoms.
[00273] [00273] In alternative embodiments, pharmaceutical formulations for oral administration are in a daily amount of between about 1 to 100 or more mg per kg of body weight per day. Lower dosages may be used, in contrast to oral administration, into the bloodstream, into a body cavity or into the lumen of an organ. Substantially higher dosages can be used for topical or oral administration or for administration by means of powders, sprays or by inhalation. Actual methods for preparing parenterally or non-parenterally administrable formulations will be known or will be apparent to those skilled in the art and are described in more detail in publications such as Remington: The Science and Practice of Pharmacy, 21st ed.,
[00274] [00274] Several studies have reported successful dosing to mammals using the complementary nucleic acid sequences. For example, Esau C., et al., Cell Metabolism, 3(2):87-98, 2006, reported dosing normal mice with intraperitoneal doses.
[00275] [00275] In some embodiments, the methods described herein may include co-administration with other drugs or pharmaceuticals, for example, any of the treatments of a neurodegenerative disorder described herein. kits
[00276] [00276] Also provided herein are kits that contain one or more (e.g. at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18 or 20) of any one of probes, inhibitor nucleic acids, sense nucleic acids, inflammatory marker proteins or antibodies described herein (in any combination). In some modalities,
[00277] [00277] In some embodiments, the kit may contain at least two primers (e.g. at least 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32 , 36, 38, or 40) to amplify a sequence present within any of the microRNAs listed in Tables 1-19 (e.g., mature microRNA or precursor microRNA) or to amplify a sequence present within any of the mRNAs listed in Tables 20 and 21.
[00278] [00278] In some embodiments, kits contain two or more primer sets (e.g. 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108 or 109 primer pairs) that amplify a sequence present within one or more ( for example 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 , 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76 , 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 109 primer pairs) of the microRNAs listed in any of Tables 1-11 (e.g., one or more (e.g., 3, 4 , 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 , 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54 , 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 , 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97,
[00279] [00279] In some embodiments, kits contain two or more primer sets (e.g. 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108 or 109 primer pairs) that amplify a sequence present within one or more ( for example 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 , 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76 , 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 109 primer pairs) of the microRNAs listed in any of Tables 1-11 (e.g., one or more (e.g., 3, 4 , 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 , 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54 , 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78,
[00280] [00280] In some embodiments, kits contain two or more antisense oligonucleotides (e.g. 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 , 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42 , 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67 , 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92 , 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108 or 109 primer pairs) that can collectively hybridize one or more (e.g. , 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 , 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52 , 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77 , 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 10 0, 101, 102, 103, 104, 105, 106, 107, 108, or 109) of the microRNAs listed in any of Tables 1, 2, and 12-19 (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70,
[00281] [00281] In some embodiments, kits contain two or more antisense oligonucleotides (e.g. 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 , 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42 , 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67 , 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92 , 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108 or 109 antisense oligonucleotides) that can collectively hybridize to one or more (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97 , 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 109) of the microRNAs listed in any of Tables 1, 2, and 12-19 (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49,
[00282] [00282] In some embodiments, the kit may contain at least two antisense molecules (e.g., at least 4, 6, 8, 10, 12, 14, 16, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, or 40) to hybridize to a sequence present within any of the microRNAs listed in Tables 1-19 (e.g., mature microRNA or precursor microRNA) or a sequence within any of the mRNAs listed in Tables 20 and 21.
[00283] [00283] In some embodiments, the kits may contain at least one inhibitor nucleic acid and/or at least one sense nucleic acid (e.g., any of the inhibitor nucleic acids or sense nucleic acids described herein). In some embodiments, the kit contains at least one inhibitor nucleic acid (e.g., at least one inhibitor nucleic acid that targets hsa-miR-155) formulated for intrathecal or intracranial injection or infusion.
[00284] [00284] In some embodiments, kits may contain at least one (e.g. at least two, three, four, five or six) antibodies that specifically bind to any of the proteins encoded by any of the genes of the inflammatory marker listed in Table 20 or Table 21 (e.g., any of the variety of antibodies or antibody fragments described herein). In some embodiments, the antibodies may be labeled (eg, labeled with a fluorophore, a radioisotope, an enzyme, biotin, or avidin).
[00285] [00285] In some embodiments, the kit additionally contains at least one additional therapeutic agent (e.g., one or more of KNS760704, SB509, ceftriaxone, minocycline, rilutek, and riluzole). In some embodiments, the kit additionally contains instructions for administering at least one agent (e.g., one or more inhibitory nucleic acids) to an individual who has or has been diagnosed as having a neurodegenerative disease (e.g., sporadic ALS). - hint and/or familiar ALS, or MS).
[00286] [00286] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
[00287] [00287] Lys6CHi/CCR2+ monocytes participate in tissue damage and disease pathogenesis in a variety of conditions, including an animal model of MS (King et al., Blood 113:3190-3197, 2009). Experiments were performed to compare the profile of microRNA expression in CD39+ microglia (Figure 1A-1C), Ly6CHi monocytes (Figure 2A-2C) and Ly6CLow monocytes (Figure 3A-3C) and in the SOD1G93A mouse model. of ALS in the pre-symptomatic stage (60 days), at the onset of symptoms and in the final stage of the disease for expression in the same cells in non-transgenic "litermates".
[00288] [00288] These data were pooled using the TaqMan Low Density Rodent Arrays (Taq-Man MicroRNA Assays containing 364 mouse microRNA assays (n=2 arrays for each group; cluster of 5-6 mice per The microarray data were normalized using Quantile (R software) to remove variation between samples. The microRNA expression level was normalized using dCT against U6 miRNA (internal control) and the geometric mean across all After the normalization step, analysis of intergroup variants (ANOVA) was used to define significantly altered microRNAs across all disease stages in SOD1 mice (using a false verification rate of 0.1).
[00289] [00289] MicroRNA profiling of Ly6CHi and Ly6CLow spleen-derived monocytes from SOD1 mice during all stages of the disease showed 32 significantly dysregulated microRNAs in Ly6CHi splenic monocytes and 23 dysregulated microRNAs in Ly6CLow splenic monocytes. All dysregulated microRNAs in monocyte subsets were observed one month before clinical onset and during disease progression. Most of these microRNAs were not overlapping between Lys6CHi monocytes and Ly6CLow monocytes, suggesting that these different monocyte subsets have different functions during disease progression. Inflammation-related microRNAs such as let-7a, miR-27a, miR-34a, miR-132, miR-146a, miR-451 and miR-155 were significantly up-regulated in Ly6CHi monocytes in the spleen during disease progression in SOD1 mice (figure 2). Ingenuity pathway analysis of the Ly6CHi monocyte microRNA profile in SOD1 mice identified the patterns of microRNA expression seen in musculoskeletal disorders.
[00290] [00290] CD39+ microglial microRNA expression profiling data in SOD1 mice show that 24 microRNAs were up-regulated and two microRNAs were down-regulated compared to the same cells in "litermates" non transgenic. These microRNAs were different from deregulated microRNAs in Ly6CHi monocytes, with the exception of 6 microRNAs (let-7a, miR-27a, miR-34a, miR-132, miR-146a and miR-155). These data demonstrate differences between CD39-identified resident microglia and Ly6C-infiltrating monocytes and identify a unique pattern of microRNA in microglia in SOD1 mice. Example 2. Deregulated MicroRNAs in CD14+CD16-Monocytes in ALS and MS Subjects
[00291] [00291] In view of the unique microRNA profiles observed in mouse monocytes, microRNA expression profiling was performed on CD14+CD16-monocytes derived from human blood (Ly6CHi analogue) of ALS subjects and MS subjects . In these experiments, nCounter expression profiling of 664 microRNAs was performed on the blood-derived CD14+CD16-monocytes of subjects who have sporadic ALS (n=8), subjects who have relapsing-remitting MS (n=8) and of healthy controls (n=8). The microRNA expression level was normalized against a geometric mean of five housekeeping genes (ACTB, B2M, GAPDH, RPL19 and RPLP0). A heat map comparing the expression of microRNA in monocytes from individuals with ALS or MS compared to expression in healthy controls was generated using ANOVA with Dunnett's post hoc test (p<0.01) (Figures 5, 6 and 33, respectively). Figure 7A depicts the number of uniquely up-regulated microRNAs on CD14+CD16-monocytes from ALS and MS subjects,
[00292] [00292] Dysregulation of specific microRNAs in CD14+ CD16- monocytes from ALS and MS subjects (compared to healthy controls) was confirmed using real-time PCR. For example, real-time PCR was used to confirm upregulation of hsa-miR-27a, hsa-miR-190, hsa-miR-500, hsa-miR-155 and hsa-miR-532-3p on CD14 +CD16- monocytes from individuals with ALS (n=11) compared to the expression of these microRNAs in CD14+CD16- monocytes from healthy controls (n=8) (Mann-Whitney two-tile T test) (figure 9) . Additional real-time PCR experiments were performed to confirm the original upregulation of microRNAs on CD14+CD16-monocytes from individuals with ALS (n=8; the clinical classification of these individuals is shown in Figures 10A and 10B). ) compared to the expression of these mi-
[00293] [00293] An additional set of real-time PCR experiments was performed to verify the upregulation of hsa-miR-24, hsa-miR-93, hsa-miR-20a, of hsa-let-7a, hsa-miR -30c, hsa-miR-181a, hsa-miR-432-3p and hsa-miR-1260 on CD14+CD16- monocytes of in-
[00294] [00294] In addition, the original downregulation of hsa-miR-142-3p, hsa-miR-15a, hsa-miR-1537, hsa-miR-362-3p and hsa-miR-148b on CD14+CD16- monocytes from MS subjects compared to the expression of these microRNAs on CD14+CD16- monocytes from ALS subjects and healthy controls was confirmed using real-time PCR (figure 15). Example 3. Abnormal MicroRNA Levels in the Cerebrospinal Fluid of Individuals Who Have Sporadic ALS and Familial ALS
[00295] [00295] MicroRNA expression profiling was also performed using cerebrospinal fluid (CSF) from subjects who have sporadic ALS and familial ALS. The levels of microRNAs in the CSF of subjects with sporadic ALS (n=10) and familial ALS (n=5) were compared to the levels of microRNAs in the CSF of healthy controls (n=10). The resulting data show that hsa-miR-27b is increased in the CSF of individuals who have sporadic and familial ALS compared to the level of this microRNA in the CSF of healthy controls and that hsa-miR-99b, hsa-miR-146a , hsa-miR-150, hsamiR-328, and hsa-miR-532-3p are exceptionally up-regulated in the CSF of individuals who have sporadic ALS compared to the levels of these microRNAs in the CSF of healthy controls or individuals who have sporadic ALS. have familial ALS (figure 16). Example 4. Inflammation-Related Genes Are Also Deregulated on CD14+CD16-Monocytes of Individuals Who Have ALS and MS
[00296] [00296] The analysis to determine the expression profile of 179 inflammation-related genes ("inflammatory marker genes") was performed using the CD14+CD16 monocytes from individuals with ALS (n=8), from individuals with MS (n=11) and healthy controls (n=10). A heat map showing the change in the expression of different inflammatory marker genes on CD14+CD16- monocytes from individuals with ALS or MS, compared to the expression of these genes on CD14+CD16- monocytes from healthy individuals is shown in figure 17. ). A volcano diagram of dysregulated inflammatory marker genes on CD14+CD16-monocytes from ALS and MS subjects compared to the expression of these genes on CD14+CD16-monocytes from healthy controls is shown in Figure 18A (graph at right). left and right graph, respectively). A list of up-regulated or down-regulated inflammatory marker genes on CD14+CD16-monocytes from ALS and MS subjects compared to the expression of these genes on CD14+CD16-monocytes from healthy controls is shown in Figure 18B. Example 5. MicroRNAs Are Also Deregulated on CD14+CD16+ Monocytes of Individuals with ALS
[00297] [00297] MicroRNA expression profiling was also performed using CD14+CD16+ monocytes from ALS subjects (n=11) and healthy controls (n=8) (figure 19). These data show that hsa-miR-708 is increased on CD14+CD16+ monocytes from individuals with ALS compared to the expression of this microRNA on CD14+CD16- monocytes from healthy individuals.
[00298] [00298] nCounter expression profiling was performed to identify additional deregulated microRNAs in CD14+CD16+ ALS monocytes (n=8) of individuals with MS (n=8) compared to microRNAs expression in CD14+ CD16+ monocytes from healthy individuals (n=8). The data in these experiments were normalized against a geometric mean of five different housekeeping genes (ACTB, B2M, GAPDH, RPL19 and RPL10). In these experiments, the expression of 664 microRNAs was analyzed (figures 20a-c). A heat map of the relative expression of microRNAs on CD14+CD16+ monocytes from subjects with ALS and subjects with MS compared to the expression of these microRNAs on CD14+CD16+ monocytes from healthy controls is shown in Figure 21A and Figure 20B, respectively. A summary of significantly dysregulated microRNAs on CD14+CD16+ monocytes from ALS and MS subjects compared to the expression of these microRNAs on CD14+CD16+ monocytes from healthy controls is shown in Figure 20C. Example 6. Pro-inflammatory Markers Expressed in Ly6CHi Monocytes and CD39+ Microglia of SOD1G93A Mice
[00299] [00299] The gene expression profile of Ly6CHi monocytes were isolated from the spleen of SOD1 mice one month before clinical disease onset and during disease progression. Pro-inflammatory genes were expressed at both time points (Figure 21A). Of the 179 inflammatory marker genes measured by nCounter, 97 were detected as having their expression altered (compared to Ly6CHi monocytes from non-transgenic litermates): 40 genes were up-regulated in Ly6CHi monocytes from SOD1 mice (in compared to non-GMO Litemates) in at least one stage of the disease. Seven genes were down-regulated in Ly6CHi monocytes in SOD1 mice compared to Ly6CHi monocytes from non-transgenic litermates, including TGF 1 and the TGF receptor 1 (Figure 21B). Biological network analysis demonstrates that the pathways most significantly affected in the present analysis relate to inflammatory responses, including CREB1, NF-kB, PU.1, and PPAR (Figure 21C). These pathways have been shown to play an important role in monocyte activation and differentiation. Gene expression profiling demonstrates a pro-inflammatory Ly6CHi monocyte population activated in the peripheral immune compartment of SOD1 mice.
[00300] [00300] Profiling the expression of CD11b+/CD39+ microglia isolated from the spinal cord and brains of SOD1 mice was performed at different stages of the disease. Of the 179 inflammatory marker genes, 120 were detected: 20 genes were up-regulated in CD11b+/CD39+ microglia of SOD1 mice (compared to CD11b+/CD39+ microglia of non-transgenic litermates) (Figure 21D) and 38 genes were down-regulated in CD11b+/CD39+ microglia of SOD1 mice (compared to CD11b+/CD39+ microglia of non-transgenic litermates) (Figure 21E). CD11b+/CD39+ microglia from SOD1 mice compared to the same cells in non-transgenic "litermates" had a marked expression of chemotaxis-related genes (eg, CCL2, CCL3, CCL4, CCL5, CXCR4 and CX-CR10). Interestingly, TGF 1 and the TGF 1 receptor were among the down-regulated genes. Biological network analysis demonstrated the activation of inflammatory pathways, with chemotaxis being the most significant (figure 21F). Expression of these genes preceded symptom onset and was observed in the spinal cord but not in the brain.
[00301] [00301] Expression of immunorelated genes on CD14+CD16-monocytes of ALS subjects was analyzed as described in Example 6. Several inflammation-related genes were up-regulated on CD14+CD16-monocytes of ALS subjects compared to controls healthy. Although there were some differences in the expression of immunorelated genes between CD14+CD16-monocytes of individuals with ALS and individuals with MS, the pattern of expression of immunorelated genes on CD14+CD16-monocytes of individuals with ALS and individuals with MS was similar. home (figure 22A-c).
[00302] [00302] In an additional set of experiments, the expression of 511 immunorelated genes was analyzed on the CD14+CD16- monocytes of individuals who have ALS (sporadic and familial ALS). These experiments were performed using the quantitative technology NanoString nCounter. The data collected from these experiments and the data described in Example 6 were further analyzed using GeneGo and Ingenuity® path analysis.
[00303] [00303] The differentially up-regulated genes in CD39+ spinal cord microglia and splenic Ly6CHi monocytes in SOD1 mice and CD14+CD16- monocytes derived from blood from individuals with sporadic ALS versus healthy controls were analyzed using GeneGo's Metacore path analysis (GeneGO, St. Joseph, MI). This method identifies transcripts that are over-represented in defined ontologies. A false check rate (FDR) filter was applied to the primary P values using the que value calculation. After enrichment, P values were calculated for all terms within the given ontology,
[00304] [00304] Targetscan 14.1 was used to investigate the statistical significance of miRNA-mRNA interactions. Targetscan 14.1 was used to predict 862044 conserved miRNA binding sites with non-zero context classification which is a conservation measure. In the SOD1 mouse dataset: miRNA target filtration analysis using Ingenuity® pathway analysis (IPA) results in 34 miRNA families that are predicted to target 10797 mRNAs. These data were filtered to include only those genes involved in the Canonical Pathway IPA categories that represent the signaling pathways involved in cellular immune response, humoral immune response, and cytokine signaling. This resulted in the filtration of the 34 microRNAs to target 971 mRN-NAs possibly involved in the signaling of the immune response. The mRNA expression studies were integrated using the NanoString platform in the analysis. 971 filtered targets contain the 47 immunorelated genes that are dysregulated in SOD1 mice, taking into account the opposite nature of miRNA-mRNA regulation. This resulted in 87 final pairs of miRNA-mRNA interactions representing 27 miRNA families and 33 mRNAs. In the expression of the miRNA of the study with individuals with ALS, it was verified that 56 miRNAs are significantly dysregulated in individuals with ALS. Filtering the 862044 predicted sites to those containing only targets of these 56 miRNAs leads to a reduction in the number of predicted sites (a reduction to 34118 sites). The number of sites was further reduced by limiting the data for mRNA targets to genes found to be regulated with an amplification shift > 1.4 in the immune panel nanostrand arrays. The final data indicate 68 unique pairs of miRNA-mRNA interactions in which the mRNA and miRNA are oppositely regulated. The statistical significance of these 68 interactions between miRNA-mRNA formed by 56 deregulated miRNAs was further evaluated as follows: 1) 1000 random networks in which 56 unregulated and randomly selected miRNAs from the study were used to find the mRNAs that contained a motif 3 '-UTR for binding and 2) the miRNA-mRNA pairs were further filtered to contain only those 59 mRNAs that were dysregulated in the ALS subjects. An average of 44.88 interactions was observed (SD=9.99). The true interactions determined in the expression studies are 68, and correspond to a significant P value (< 1.1 x 10-15). A similar analysis for the regulated miRNA-mRNA pairs in SOD1 mice shows an interaction distribution with a mean of 15.26 (SD=4.03), since the true interactions between miRNA-mRNA determined experimentally are of 41, with a significant P-value < 5.7 x 10-9.
[00305] [00305] The data show that CD14+CD16- monocytes from ALS subjects have a unique expression of immunorelated genes compared to CD14+CD16- monocytes from healthy controls. Furthermore, some of the immunorelated genes are differentially expressed on CD14+CD16- monocytes of individuals with sporadic ALS compared to CD14+CD16- monocytes of individuals with familial ALS (Figures 23A-C). These results were validated using singleplex qPCR in an independent cohort of ALS patients and healthy controls (changes in CCL2, AHR, PTAFR, NF-kB, TRAF3, FCER1A, CXCR4, and SOCS1 expression were validated) (Figure 24). These data confirm that CCL2, AHR, PTAFR, NF-kB and TRAF3 are up-regulated on CD14+CD16-monocytes from ALS subjects compared to CD14+CD16-monocytes from healthy controls and that CXCR4 and SOCS1 are up-regulated to low in CD14+CD16- monocytes from individuals with ALS compared to CD14+CD16- monocytes from healthy controls.
[00306] [00306] An additional microRNA-mRNA target filter analysis through Ingenuity revealed that the top 10 microRNA-miRNA interactions in Ly6CHi cells of SOD1 mice were linked to genes found to be the most significantly dysregulated. in the CD14+CD16-monocytes of individuals with ALS (Figure 25).
[00307] [00307] A further evaluation of miRNA and mRNA expression profile in CD14+CD16- monocytes from individuals with ALS shows that abnormalities related to gene and miRNA expression in CD14+CD16- monocytes are linked to inflammatory genes and immunorelated (figure 26 and 27). When these interactions between miRNA-mRNA on CD14+CD16- monocytes were analyzed, the interactions were shown to be statistically significant using the Targetscan 4.1 prediction analysis in SOD1 mice and ALS subjects (figure 28). In addition, GeneGo's pathway analysis identified 9 inflammation-related networks (Figure 29). These networks of inflammation were identical to those observed (in the studies described here) as they were dysregulated in Ly6CHi monocytes in SOD1 mice. Example 8. Therapeutic Role of miR-155 in Model SOD1G93A
[00308] [00308] Significant upregulation of miR-155 occurs in spleen-derived Ly6CHi monocytes and spinal cord-derived microglia prior to clinical onset, which increased during all stages of disease progression in SOD1G93A mice (see data above ). Additional experiments were performed to determine whether miR-155 plays a role in the development/pathogenesis of ALS. In these experiments, the SOD1 mouse (a model of ALS) was further genetically engineered to knockdown or knockout miR-155 expression. Animals and Behavior Analysis
[00309] [00309] Wild type B6/SJL-SOD1G93A Tg and SOD1 (WT) were provided by Prize4Life or purchased from Jackson Laboratories. ALS mice were analyzed at time points of days 30 and 60 (pre-symptomatic), days 90-100 (onset of symptoms), and days 120-140 (end of symptoms/end stage). The onset of symptoms was defined by the peak of the weight curve and the visible signs of muscle weakness. End-stage disease was determined by the animal care and symptomatic progression guidelines (thus, ranged from 135 time points by ±5 days). Disease progression was documented according to established methodology provided by Prize4Life and Jackson Laboratories. Symptomatic analysis was conducted by daily monitoring and weight measurements every 3-4 days starting on day 80. Symptom onset was defined as the time when animals began to decrease in weight. Neurological scores for both hind paws were assessed daily for each mouse, starting at 50 days of age. The neurological score used a range from 0 to 4 developed by the ALS Therapy Development Institute (ALSTDI). The criteria used to assign each level of eclassification were: 0= complete extension of the hind legs away from the lateral midline when the mouse is suspended by its tail and the mouse can maintain this position for 2 seconds, suspended 2–3 times; 2=collapse or partial collapse of the paw extension towards the lateral midline (weakness) or tremor of the hind paws during tail suspension; 2=curling the toes and dragging at least one limb when walking; 3=rigid paralysis or minimal joint movement, non-use of the foot to move forward; and 4=mouse cannot straighten up for 30 seconds on either side, euthanasia. Generation of SOD1G93A/miR-155-/-
[00310] [00310] Male SOD1G93A [B6.Cg-Tg(SOD1G93A) 1Gur/J] mice were bred with non-Tg C57Bl/6 miR155-/- females. Non-transgenic miR155-/- was backcrossed to F1-SOD1G93A/miR155-/+ to produce F2-SOD1G93A/MIR155-/- with a miR155 knockout. The mice were clinically evaluated by the neurobehavioral test (turning bar performance and neurological classification) and the survival of three experimental groups of SOD1 mice with different levels of miR-155 expression was evaluated: 1) SOD1G93A/miR155+/+ ; 2) SOD1G93A/miR155-/+; and 3) SOD1G93A/miR155-/-. MiR-155 targeting in SOD1 mice
[00311] [00311] To prove a direct interaction between miRNAs and their targets, a Luciferase reporter that carries 3'UTR with potential miRNA binding sites is used. Site-directed mutagenesis of the miRNA binding site eliminates the responsiveness of reporter Luciferase to miRNA modulation, which will provide evidence of direct targeting. Flow Cytometry
[00312] [00312] Mononuclear cells were isolated directly from the spinal cord of mice, as described in Cardona et al. (Nat. Protoc. 1:1947-1951, 2006) except that no dispase was used since dispase was found to cleave di-
[00313] [00313] NanoString nCounter technology was used to study the expression of up to 800 inflammation-related genes. Multiplexed target profiling of 179 inflammation-related transcripts consisting of genes differentially expressed during inflammation and immune responses was also performed as described above.
[00314] [00314] The resulting data show that SOD1G93A/miR155-/- animals have a significant delay in disease onset and survival compared to SOD1G93A animals (Tables 22 and 23 and Figures 30-34). The body weight of the mice was evaluated every
[00315] [00315] SOD1G93A/miR155-/- animals also had a significant reduction in the recruitment of peripheral monocytes associated with the protection of microglia in the spinal cord, compared to SOD1G93A mice (figure 35) and a significant reduction in expression of genes related to inflammation in spinal cord microglia and Ly6CHi monocytes compared to SOD1G93A mice (figure 36). Few inflammation-related genes were affected in splenic T cells; however, the expression of anti-inflammatory genes (IL4 and IL10) was reversed at the level of non-transgenic mice, suggesting that miR-155 may primarily affect the activation of the M1-associated signature in Ly6CHi monocytes in SOD1G93A mice.
[00316] [00316] These data indicate that miR-155 plays a significant role in the development (pathogenesis) of ALS and that the treatment of individuals who have a neurodegenerative disorder (e.g. ALS, e.g. familial ALS and/or sporadic ALS ) can be obtained by administering at least one inhibitory nucleic acid that targets hsa-miR-155 (e.g., precursor or mature hsa-miR-155) to a subject with a neurodegenerative disorder (e.g., ALS, e.g. example, familial ALS and/or sporadic ALS). Exemplary inhibitor nucleic acids that target hsa-miR-155 (e.g., precursor or mature hsa-miR-155) that can be administered to a subject having a neurodegenerative disorder are described herein. Example 9. Efficacy of antagomir miR-155 for the treatment of SOD1G93A mice
[00317] [00317] A first set of experiments was performed on the SOD1G93A model of familial ALS to determine whether an antagomir targeting miR-155 would alter miRNA expression and/or inflammatory gene expression in spinal cord-derived microglia and Ly6CHi splenic monocytes. In these experiments, the following five experimental groups were studied.
[00318] [00318] Group I. miR-155 of mixed control (intraperitoneal injection, 2 mg per injection, every three days) (n=3). mixed control miR-155: +TC+AA+C+A+TTA+G+A+CT+T+A (SEQ ID NO.: 263) ("+" indicates the presence of a portion of LNA).
[00319] [00319] Group II. Low dose of antagomir miR-155 (intravenous injection, 0.2 mg per injection, every three days) (n=3). Antagomir miR-155: +TC+AC+A+A+TTA+G+C+AT+T+A (SEQ ID NO.: 262) ("+" indicates the presence of a portion of LNA).
[00320] [00320] Group III. High dose of antagomir miR-155 (intravenous injection, 2 mg per injection, every three days) (n=3).
[00321] [00321] Group IV. Low dose of antagomir miR-155 (intraperitoneal injection, 0.2 mg per injection every three days) (n=3).
[00322] [00322] Group V. High dose of antagomir miR-155 (intraperitoneal injection, 2 mg per injection every three days) (n=3).
[00323] [00323] Analysis of inflammatory gene expression and miRNA Nanostring was performed on spinal cord-derived microglia and splenic Ly6CHi monocytes as described above.
[00324] [00324] A comparison of splenic Ly6C microglia and monocyte data from SOD1 mice that received a low dose (0.2 mg/kg body weight per injection) versus a high dose (2 mg/kg body weight per injection), every three days (ip or iv), shows that the low dose does not affect the M1 phenotype of the splenic Ly6CHi monocyte (the same expression of miRNA and inflammatory genes is observed in these mice compared to mice untreated SOD1). However, a high dose (administered i.p. or i.v.) inhibited the expression of pro-inflammatory cytokines, as measured by quantitative nCounter technology for inflammation-related genes. The data also show that spinal cord-derived microglia were not affected by systemic treatment with antagomir miR-155.
[00325] [00325] A second set of experiments is performed to determine the effect of antagomir miR-155 on the behavior and survival of SOD1 mice. In these experiments, SOD1 mice receive a mixed miR-155 (n=10) or an antagomir miR-155 by intraperitoneal injection of 2 mg/kg body weight per injection every three days (n=10) . Treatment is initiated at the onset of the disease (defined by body weight loss and neurological classification). Mice are treated continuously until the end of the experiment or final stage. The behavior of the mice is determined, for example, by their performance on the turntable, and the body weight and survival of the mice are monitored.
[00326] [00326] A third set of experiments is designed to investigate whether miR-155 in the central nervous system of SOD1 mice can be targeted using lentivirus-mediated inhibition of miR-155. In these experiments, antagomir miR155 is applied by lentivirus infection. For miR-155 inhibition, a sequence encoding the miR-155 mutant or its specific inhibitor is cloned into a lentiviral vector (Genecopoeia). The virus is produced by infecting target cells according to the user manual. About 2x107 transformation units of the recombinant lentivirus are applied to SOD1 mice by stereotaxic injection into the CSF or the lateral ventricle. The treatment groups are: Group I. Mice that received a GFP-labeled high dose of mixed miR-155/lentivirus control (n=10). (See the mixed antagomir control sequence of SEQ ID NO.: 263.) Group II. Mice that received a GFP-labeled high dose of antagomir lentivirus miR-155 (n=10). (See the miR-155 antagomir sequence of SEQ ID NO.: 262.)
[00327] [00327] The behavior of the mice is followed, for example, by the performance on the turntable and by monitoring the body weight and survival of the mice. Nanostring miRNA and profiling of immunorelated genes of the innate immune system and profiling of genes related to T-cell inflammation are also performed on cells derived from these mice (e.g., peripheral cells of T-cells). Lys6CHi).
[00328] [00328] nCounter expression analysis was also performed to determine the expression of various microRNAs in spleen-derived Ly6CHi monocyte subsets in wild-type SOD1/miR155-/+, SOD1/miR155-/- mice. The data show that several microRNAs were expressed differently in wild-type mice compared to SOD1/miR155-/+ mice and between SOD1/miR155-/+ and SOD1/miR155-/- mice (figure 37).
[00329] [00329] The determination of the nCounter expression profile of CD14+CD16- monocytes derived from blood for sporadic ALS (8 human subjects) and relapsing-remitting multiple sclerosis (8 human subjects) microRNAs compared to the microRNAs expression in CD14+CD16- monocytes from healthy controls (8 subjects) was also performed. The resulting heat map in figure 38 shows the results of analysis of variance (ANOVA) using Dunnett's post hoc test (P<0.01). Up-regulated or down-regulated microRNAs on CD14+CD16-monocytes from ALS subjects (compared to the expression of these microRNAs on CD14+CD16-monocytes from healthy controls) are indicated. OTHER MODALITIES
[00330] [00330] It should be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description serves to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims.
Other aspects, advantages and modifications are within the scope of the following claims.

权利要求:
Claims (39)
[1]
1. Inhibitor nucleic acid, characterized in that it comprises a sequence that is complementary to a contiguous sequence present in hsa-miR-155, for example, a contiguous sequence of at least 5 nucleotides, for use in the treatment of sclerosis. - amyotrophic lateral sclerosis (ALS) in an individual.
[2]
2. A method for treating amyotrophic lateral sclerosis (ALS) in a subject, comprising administering to a subject having ALS at least one antagomir that comprises a sequence that is complementary to a sequence contiguous, for example, a contiguous sequence of at least 5 nucleotides, present in any one of hsa-miR-155, hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa -miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa -miR-29c, hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b, hsa-miR-24, hsa-miR-181a, hsa-miR-103, hsa-miR -532-3p, hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, hsa-miR-15b and hsa-miR-miR-19a.
[3]
3. A method for treating amyotrophic lateral sclerosis (ALS) in a subject, comprising administering to a subject having ALS at least one inhibitory nucleic acid comprising a sequence that is complementary to a sequence contiguous, for example, a contiguous sequence of at least 5 nucleotides, present in hsa-miR-155.
[4]
4. Method according to claim 3, characterized in that at least one inhibitor nucleic acid is an antagomir.
[5]
5. Method according to claim 4, characterized in that antagomir has a sequence of SEQ ID NO.: 262.
[6]
6. Method according to claim 3, characterized in that at least one inhibitor nucleic acid is an antisense oligonucleotide.
[7]
7. Method according to claim 3, characterized in that at least one inhibitor nucleic acid is a ribozyme.
[8]
8. Method according to claim 3, characterized in that at least one inhibitory nucleic acid is injected into the cerebrospinal fluid of an individual.
[9]
9. Method according to claim 8, characterized in that the injection is intracranial injection.
[10]
10. Method according to claim 8, characterized in that the injection is intrathecal injection.
[11]
11. Method according to claim 3, characterized in that at least one inhibitor nucleic acid is complexed with one or more cationic polymers and/or cationic lipids.
[12]
12. Method for diagnosing amyotrophic lateral sclerosis (ALS) in an individual, characterized in that it comprises: determining a level of one or more microRNAs selected from the group consisting of: hsa-miR -19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR -374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b , hsa-miR-24, hsa-miR-181a, hsa-miR-103, hsa-miR-155, hsa-miR-532-3p, hsa-miR-518f, hsa-miR-206, hsa-miR-204 , hsa-miR-137, hsa-miR-453, hsa-miR-146a, hsa-miR-603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a, hsa-miR-615-5p , hsa-miR-655, hsa-miR-450b-5p, hsa-miR-548b-3p, hsa-miR-584, hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR -328, hsa-miR-421, hsa-miR-580, hsa-miR-15b and hsa-miR-19a on an individual's CD14+CD16-monocyte; and comparing the level of one or more of the microRNAs in an individual's CD14+CD16-monocyte with a reference level of one or more microRNAs; wherein an increase in the level of one or more of hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hs-miR-27a, hsa -miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR -223, hsa-miR-26a, hsa-miR-26b, hsa-miR-24, hsa-miR-181a, hsa-miR-103, hsa-miR-155, hsa-miR-532-3p, hsa-miR -15b and has-miR-19a and/or a decrease in the level of one or more of hsa-miR-518f, hsa-miR-206, hsa-miR-204, hsa-miR-137, hsa-miR-453 , hsa-miR-146a, hsa-miR-603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a, hsa-miR-615-5p, hsa-miR-655, hsa-miR-450b -5p, hsa-miR-548b-3p, hsa-miR-584, hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328, hsa-miR-421, hsa-miR -580 on an individual's CD14+CD16-monocyte compared to the reference level indicates that the individual has ALS.
[13]
13. Method for diagnosing amyotrophic lateral sclerosis (ALS) in an individual, characterized in that it comprises: determining a level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-miR-532-3p in cerebrospinal fluid (CSF) in a subject; and comparing the level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-miR-532-3p in the Subject CSF at a baseline level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p , wherein an increase in the level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-miR-532- 3p in the individual's CSF compared to the reference level.
ence indicates that the individual has ALS.
[14]
14. Method for the diagnosis of familial amyotrophic lateral sclerosis (ALS) in an individual, characterized in that it comprises: the determination of a level of hsa-miR-27b and a level of one or more of hsa-miR- 99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-miR-532-3p in the cerebrospinal fluid (CSF) of a subject; and comparing the level of hsa-miR-27b in the individual's CSF to a reference level of hsa-miR-27b and the level of one or more of hsa-miR-99b, hsa-miR-146a, hsa- miR-150, hsa-miR-328 and hsa-miR-miR-532-3p in the subject's CSF at a reference level of one or more of hsa-miR-99b, hsa-miR-146a, hsa-miR-150 , hsa-miR-328 and hsa-miR-miR-532-3p; wherein an increase in the level of hsa-miR-27b in the subject's CSF compared to the reference level of hsa-miR-27b and a decrease or no significant change in the level of one or more of hsa-miR-99b, hsa- miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-miR-532-3p in the subject's CSF compared to the reference level of one or more of hsa-miR-99b, hsa-miR- 146a, hsa-miR-150, hsa-miR-328 and hsa-miR-miR-532-3p indicate that the individual has familial ALS.
[15]
15. Method for diagnosing sporadic amyotrophic lateral sclerosis (ALS) in an individual, characterized in that it comprises: determining a level of two or more microRNAs selected from the group consisting of hsa-miR-27b , hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p in the cerebrospinal fluid (CSF) of a subject; and comparing the level of two or more microRNAs in the subject's CSF to a reference level of two or more microRNAs; where an increase in the level of two or more microRNAs in the subject's CSF compared to the reference level indicates that the subject has sporadic ALS.
[16]
16. Method for identifying an individual at risk of developing amyotrophic lateral sclerosis (ALS), characterized in that it comprises: determining a level of one or more microRNAs selected from the group consisting of: hsa-miR-19b , hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b , hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b, hsa -miR-24, hsa-miR-181a, hsa-miR-103, hsa-miR-155, hsa-miR-532-3p, hsa-miR-518f, hsa-miR-206, hsa-miR-204, hsa -miR-137, hsa-miR-453, hsa-miR-146a, hsa-miR-603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a, hsa-miR-615-5p, hsa -miR-655, hsa-miR-450b-5p, hsa-miR-548b-3p, hsa-miR-584, hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328 , hsa-miR-421, hsa-miR-580, hsa-miR-15b and hsa-miR-19a on a subject's CD14+CD16-monocyte; and comparing the level of one or more microRNAs in an individual's CD14+CD16-monocyte with a reference level of one or more microRNAs; wherein an increase in the level of one or more of hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hs-miR-27a, hsa -miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR -223, hsa-miR-26a, hsa-miR-26b, hsa-miR-24, hsa-miR-181a, hsa-miR-103, hsa-miR-155, hsa-miR-532-3p, hsa-miR -15b and hsa-miR-miR-19a and/or a decrease in the level of one or more of hsa-miR-518f, hsa-miR-206, hsa-miR-204, hsa-miR-137, hsa-miR- 453, hsa-miR-146a, hsa-
miR-603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a, hsa-miR-615-5p, hsa-miR-655, hsa-miR-450b-5p, hsa-miR-548b- 3p, hsa-miR-584, hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328, hsa-miR-421 and hsa-miR-miR-580 on a CD14+CD16 -The individual's monocyte compared to the reference level indicates that the individual has an increased risk of developing ALS.
[17]
17. Method for identifying an individual at risk of developing amyotrophic lateral sclerosis (ALS) in an individual, characterized in that it comprises: determining a level of one or more of hsa-miR-27b, hsa-miR- 99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-miR-532-3p in cerebrospinal fluid (CSF) in a subject; and comparing the level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-miR-532-3p in the Subject CSF at a baseline level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p , wherein an increase in the level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-miR-532- 3p in the individual's CSF compared to the reference level indicates that the individual has an increased risk of developing ALS.
[18]
18. Method for the identification of an individual at risk of developing familial amyotrophic lateral sclerosis (ALS), characterized by the fact that it comprises: the determination of a level of hsa-miR-27b and a level of one or more of hsa -miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-miR-532-3p in the cerebrospinal fluid (CSF) of a subject; and comparison of the level of hsa-miR-27b in the individual's CSF
duo at a reference level of hsa-miR-27b and the level of one or more of hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hs-miR-miR- 532-3p in the subject's CSF at a reference level of one or more of hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-miR-532-3p ; wherein an increase in the level of hsa-miR-27b in the subject's CSF compared to the reference level of hsa-miR-27b and a decrease or no significant change in the level of one or more of hsa-miR-99b, hsa- miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-miR-532-3p in the subject's CSF compared to the reference level of one or more of hsa-miR-99b, hsa-miR- 146a, hsa-miR-150, hsa-miR-328 and hsa-miR-miR-532-3p indicate that the individual has an increased risk of developing familial ALS.
[19]
19. Method for the identification of an individual at risk of developing sporadic amyotrophic lateral sclerosis (ALS), characterized by the fact that it comprises: the determination of a level of two or more microRNAs selected from the group consisting of hsa- miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p in the cerebrospinal fluid (CSF) of a subject; and comparing the level of two or more microRNAs in the subject's CSF with a reference level of two or more microRNAs; where an increase in the level of two or more microRNAs in the individual's CSF compared to the reference level indicates that the individual has an increased risk of developing sporadic ALS.
[20]
20. Method for predicting the rate of disease progression in an individual who has amyotrophic lateral sclerosis (ALS), characterized in that it comprises: determining a level of one or more microRNAs selected from the group that consists of: hsa-miR-19b, hsa-miR-106b,
hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b, hsa-miR-24, hsa- miR-181a, hsa-miR-103, hsa-miR-155, hsa-miR-532-3p, hsa-miR-518f, hsa-miR-206, hsa-miR-204, hsa-miR-137, hsa- miR-453, hsa-miR-146a, hsa-miR-603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a, hsa-miR-615-5p, hsa-miR-655, hsa- miR-450b-5p, hsa-miR-548b-3p, hsa-miR-584, hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328, hsa-miR-421, hsa-miR-580, hsa-miR-15b and hsa-miR-19a on a subject's CD14+CD16-monocyte; and comparing the level of one or more microRNAs in an individual's CD14+CD16-monocyte to a reference level of one or more microRNAs; wherein an increase in the level of one or more of hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hs-miR-27a, hsa -miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR -223, hsa-miR-26a, hsa-miR-26b, hsa-miR-24, hsa-miR-181a, hsa-miR-103, hsa-miR-155, hsa-miR-532-3p, hsa-miR -15b and hsa-miR-miR-19a and/or a decrease in the level of one or more of hsa-miR-518f, hsa-miR-206, hsa-miR-204, hsa-miR-137, hsa-miR- 453, hsa-miR-146a, hsa-miR-603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a, hsa-miR-615-5p, hsa-miR-655, hsa-miR- 450b-5p, hsa-miR-548b-3p, hsa-miR-584, hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328, hsa-miR-421 and hsa- miR-miR-580 on an individual's CD14+CD16-monocyte compared to the reference level indicates that the individual will have an increased rate of disease progression.
[21]
21. Method for predicting the rate of disease progression in an individual who has amyotrophic lateral sclerosis (ALS), characterized in that it comprises:
determining a level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-miR-532-3p in the cerebrospinal fluid (CSF) in an individual; and comparing the level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-miR-532-3p in the Subject CSF at a baseline level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p , wherein an increase in the level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-miR-532- 3p in the individual's CSF compared to the baseline indicates that the individual will have an increased rate of disease progression.
[22]
22. The method of claim 20 or claim 21, characterized in that an increase in the rate of disease progression is an increased rate of an onset of one or more symptoms of ALS, an increase in worsening of one or more ALS symptoms, an increase in the frequency of one or more ALS symptoms, an increase in the duration of one or more ALS symptoms, or a decrease in the individual's longevity.
[23]
23. Method for the selection of an individual for the treatment of amyotrophic lateral sclerosis (ALS), characterized in that it comprises: the determination of a level of one or more microRNAs selected from the group consisting of: hsa- miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa- miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR- 26b, hsa-miR-24, hsa-miR-181a, hsa-miR-103, hsa-miR-155, hsa-miR-532-3p, hsa-miR-518f, hsa-miR-206, hsa-miR- 204, hsa-miR-137, hsa-
miR-453, hsa-miR-146a, hsa-miR-603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a, hsa-miR-615-5p, hsa-miR-655, hsa- miR-450b-5p, hsa-miR-548b-3p, hsa-miR-584, hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328, hsa-miR-421, hsa-miR-580, hsa-miR-15b and hsa-miR-19a on a subject's CD14+CD16-monocyte; comparing the level of one or more microRNAs in an individual's CD14+CD16-monocyte to a reference level of one or more microRNAs; and selecting an individual that has an increased level of one or more of hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa -miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR -29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b, hsa-miR-24, hsa-miR-181a, hsa-miR-103, hsa-miR-155, hsa-miR-532 -3p, hsa-miR-15b and hsa-miR-miR-19a and/or a decrease in the level of one or more of hsa-miR-518f, hsa-miR-206, hsa-miR-204, hsa-miR- 137, hsa-miR-453, hsa-miR-146a, hsa-miR-603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a, hsa-miR-615-5p, hsa-miR- 655, hsa-miR-450b-5p, hsa-miR-548b-3p, hsa-miR-584, hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328, hsa- miR-421 and hsa-miR-miR-580 on a CD14+CD16-monocyte compared to the reference level for the treatment of ALS.
[24]
24. Method for selecting an individual for the treatment of amyotrophic lateral sclerosis (ALS), characterized in that it comprises: determining a level of one or more of hsa-miR-27b, hsa-miR-99b , hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-miR-532-3p in cerebrospinal fluid (CSF) in a subject; and comparing the level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-
miR-532-3p in the subject's CSF at a reference level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hs-miR-328 and hsa -miR-miR-532-3p; and selecting an individual that has an increased level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR -miR-532-3p in CSF compared to the reference level for the treatment of ALS.
[25]
25. Method for the selection of an individual for the treatment of familial amyotrophic lateral sclerosis (ALS), characterized in that it comprises: the determination of a level of hsa-miR-27b and a level of one or more of hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-miR-532-3p in the cerebrospinal fluid (CSF) of a subject; and comparing the level of hsa-miR-27b in the individual's CSF to a reference level of hsa-miR-27b and the level of one or more of hsa-miR-99b, hsa-miR-146a, hsa- miR-150, hsa-miR-328 and hsa-miR-miR-532-3p in the subject's CSF at a reference level of one or more of hsa-miR-99b, hsa-miR-146a, hsa-miR-150 , hsa-miR-328 and hsa-miR-miR-532-3p; and the selection of an individual who has an increase in the level of hsa-miR-27b in the CSF compared to the reference level of hsa-miR-27b and a decrease or no significant change in the level of one or more of hsa-miR- 99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-miR-532-3p in CSF compared to the reference level of one or more of hsa-miR-99b, hsa- miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-miR-532-3p for the treatment of familial ALS.
[26]
26. Method for the selection of an individual for the treatment of sporadic amyotrophic lateral sclerosis (ALS), characterized in that it comprises: the determination of a level of two or more microRNAs selected from the group consisting of hsa- miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p in the cerebrospinal fluid (CSF) of a subject; comparing the level of two or more microRNAs in the subject's CSF to a reference level of two or more microRNAs; and selecting an individual who has an increase in the level of two or more microRNAs in the CSF compared to the reference level for the treatment of sporadic ALS.
[27]
A method according to any one of claims 23-26, characterized in that the selected individual is also administered a treatment for ALS.
[28]
28. Method for selecting an individual to participate in a clinical trial, characterized in that it comprises: determining a level of one or more microRNAs selected from the group consisting of: hsa-miR -19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR -374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b , hsa-miR-24, hsa-miR-181a, hsa-miR-103, hsa-miR-155, hsa-miR-532-3p, hsa-miR-518f, hsa-miR-206, hsa-miR-204 , hsa-miR-137, hsa-miR-453, hsa-miR-146a, hsa-miR-603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a, hsa-miR-615-5p , hsa-miR-655, hsa-miR-450b-5p, hsa-miR-548b-3p, hsa-miR-584, hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR -328, hsa-miR-421, hsa-miR-580, hsa-miR-15b and hsa-miR-19a on an individual's CD14+CD16-monocyte; comparing the level of one or more microRNAs in an individual's CD14+CD16-monocyte to a reference level of one or more microRNAs; and selecting an individual that has an increased level of one or more of hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa -miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR -29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b, hsa-miR-24, hsa-miR-181a, hsa-miR-103, hsa-miR-155, hsa-miR-532 -3p, hsa-miR-15b and hsa-miR-miR-19a and/or a decrease in the level of one or more of hsa-miR-518f, hsa-miR-206, hsa-miR-204, hsa-miR- 137, hsa-miR-453, hsa-miR-146a, hsa-miR-603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a, hsa-miR-615-5p, hsa-miR- 655, hsa-miR-450b-5p, hsa-miR-548b-3p, hsa-miR-584, hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328, hsa- miR-421 and hsa-miR-miR-580 on a CD14+CD16-monocyte compared to the baseline level for participation in a clinical trial.
[29]
29. Method for selecting an individual for participation in a clinical trial, characterized in that it comprises: determining a level of one or more microRNAs selected from the group consisting of hsa-miR- 27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-532-3p in the cerebrospinal fluid (CSF) of a subject; comparing the level of one or more microRNAs in the subject's CSF to a reference level of one or more microRNAs; and selecting an individual who has an increased level of one or more microRNAs in the CSF compared to the baseline level for participation in a clinical trial.
[30]
30. Method for determining the effectiveness of treatment of amyotrophic lateral sclerosis in an individual, characterized in that it comprises:
determining a level of one or more microRNAs selected from the group consisting of: hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p , hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa -miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b, hsa-miR-24, hsa-miR-181a, hsa-miR-103, hsa-miR-155, hsa-miR - 532-3p, hsa-miR-518f, hsa-miR-206, hsa-miR-204, hsa-miR-137, hsa-miR-453, hsa-miR-146a, hsa-miR-603, hsa-miR -1297, hsa-miR-192, hsa-miR-526a, hsa-miR-615-5p, hsa-miR-655, hsa-miR-450b-5p, hsa-miR-548b-3p, hsa-miR-584 , hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328, hsa-miR-421, hsa-miR-580, hsa-miR-15b and hsa-miR-19a in one individual's CD14+CD16-monocyte at a first time point; determining a level of one or more microRNAs on an individual's CD14+/CD16-monocyte at a second time point after administration of at least one dose of a treatment; and comparing the level of one or more microRNAs at the first time point to the level of one or more microRNAs at the second time point; wherein a decrease in the level of one or more of hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa -miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR - 223, hsa-miR-26a, hsa-miR-26b, hsa-miR-24, hsa-miR-181a, hsa-miR-103, hsa-miR-155, hsa-miR-532-3p, hsa-miR -15b and hsa-miR-miR-19a and/or an increase in the level of one or more of hsa-miR-518f, hsa-miR-206, hsa-miR-204, hsa-miR-137, hsa-miR- 453, hsa-miR-146a, hsa-miR-603, hsa-miR-1297, hsa-miR-192, hsa-miR-526a, hsa-miR-615-5p, hsa-miR-655, hsa-miR- 450b-5p, hsa-miR-548b-3p, hsa-miR-584,
hsa-miR-548f, hsa-miR-300, hsa-miR-302c, hsa-miR-328, hsa-miR-421, and hsa-miR-miR-580 at second time point compared to level(s) is) at the first time point indicates that the treatment was effective in the subject.
[31]
31. Method for determining the effectiveness of treatment of amyotrophic lateral sclerosis (ALS) in an individual, characterized in that it comprises: determining a level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-miR-532-3p in the subject's cerebrospinal fluid at a first time point; determining a level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328 and hsa-miR-miR-532-3p in the subject's CSF at a second time point after administration of at least one dose of a treatment; and comparing the level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p at the first point in time to the level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-miR-532-3p at second point in time; wherein a decrease in the level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-miR-532-3p at the second time point compared to the level(s) at the first time point indicates that the treatment was effective in the individual.
[32]
32. Method according to any one of claims 12-31, characterized in that the reference level is a threshold level.
[33]
Method according to any one of claims 12, 16, 20, 23, 28 and 30, characterized in that the reference level is a level found on a CD14+CD16-monocyte from a control individual .
[34]
34. Method according to any one of claims 13-15, 17-19, 21, 24-26, 29 and 31, characterized in that the reference level is a level found in the CSF of an individual of control.
[35]
Method according to any one of claims 12, 16, 20, 23, 28 and 30, characterized in that it additionally comprises obtaining a biological sample that contains a CD14+CD16-monocyte of the individual.
[36]
36. Method, according to claim 35, characterized in that the method additionally comprises the purification of a CD14+CD16-monocyte from the biological sample.
[37]
A method according to any one of claims 13-15, 17-19, 21, 24-26, 29 and 31, further comprising obtaining a sample containing the subject's CSF.
[38]
38. Method according to any one of claims 12-31, characterized in that the microRNA or one or more microRNAs is a precursor microRNA.
[39]
39. Method according to any one of claims 12-31, characterized in that the microRNA or one or more microRNAs is a mature microRNA.

类似技术:

---

公开号 | 公开日 | 专利标题

---

US20190276892A1|2019-09-12|Micrornas in neurodegenerative disorders

---

US10435689B2|2019-10-08|MicroRNA inhibition for the treatment of inflammation and myeloproliferative disorders

---

US10253319B2|2019-04-09|miRNA modulators of thermogenesis

---

US20140171484A1|2014-06-19|Tissue-specific micrornas and compositions and uses thereof

---

ES2661787T3|2018-04-04|Treatment of hemoglobin-related diseases | by inhibition of natural antisense transcript for hbf / hbg

---

ES2658626T3|2018-03-12|Treatment of diseases related to glial cell-derived neurotrophic factor | by inhibition of natural antisense transcript to GDNF

---

US20100202973A1|2010-08-12|Microrna molecules associated with inflammatory skin disorders

---

US9255268B2|2016-02-09|Methods for diagnosing and treating learning or mental disorders

---

US20180155414A1|2018-06-07|Targeting Apolipoprotein E | in Neurologic Disease

---

CN102892897A|2013-01-23|Compositions and methods for microrna expression profiling of lung cancer

---

EP2683411B1|2016-01-13|Methods of using microrna-26a to promote angiogenesis

---

TW201200138A|2012-01-01|Treatment of Atonal homolog 1 | related diseases by inhibition of natural antisense transcript to ATOH1

---

EP2298359A1|2011-03-23|Nucleic acid capable of controlling degranulation of mast cell

---

AU2008232316A1|2008-10-02|Therapeutic targets and molecules

---

CN102782135A|2012-11-14|Treatment of RNase H1 related diseases by inhibition of natural antisense transcript to RNase H1

---

CN102906264A|2013-01-30|Treatment of interferon regulatory factor 8 | related diseases by inhibition of natural antisense transcript to irf8

---

WO2014096418A2|2014-06-26|Micrornas as therapeutics and biomarkers for epilepsy

---

US9885042B2|2018-02-06|miR-92 inhibitors and uses thereof

---

NZ623459B2|2016-08-30|Micrornas in neurodegenerative disorders

---

EP3720962A1|2020-10-14|Methods for reactivating genes on the inactive x chromosome

同族专利:

---

公开号 | 公开日

---

MX2014004516A|2015-01-16|

---

CN104011210B|2018-05-01|

---

CN104011210A|2014-08-27|

---

US20190276892A1|2019-09-12|

---

CA2851280C|2021-05-18|

---

EP3170899A1|2017-05-24|

---

AU2012322788B2|2018-01-04|

---

JP2014534810A|2014-12-25|

---

AU2012322788A1|2014-04-24|

---

US10184151B2|2019-01-22|

---

EP2766482B1|2016-12-07|

---

EP3170899B1|2020-06-24|

---

EP2766482A4|2015-03-11|

---

KR20140074997A|2014-06-18|

---

EP2766482A1|2014-08-20|

---

NZ623459A|2016-05-27|

---

JP6234370B2|2017-11-22|

---

CA2851280A1|2013-04-18|

---

US20180023142A1|2018-01-25|

---

US20140235697A1|2014-08-21|

---

WO2013055865A1|2013-04-18|

---

HK1201294A1|2015-08-28|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US3687808A|1969-08-14|1972-08-29|Univ Leland Stanford Junior|Synthetic polynucleotides|

---

US4458066A|1980-02-29|1984-07-03|University Patents, Inc.|Process for preparing polynucleotides|

---

US4469863A|1980-11-12|1984-09-04|Ts O Paul O P|Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof|

---

US5023243A|1981-10-23|1991-06-11|Molecular Biosystems, Inc.|Oligonucleotide therapeutic agent and method of making same|

---

US4476301A|1982-04-29|1984-10-09|Centre National De La Recherche Scientifique|Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon|

---

JPH0372639B2|1982-08-09|1991-11-19|Wakunaga Seiyaku Kk|

---

FR2540122B1|1983-01-27|1985-11-29|Centre Nat Rech Scient|NOVEL COMPOUNDS COMPRISING A SEQUENCE OF OLIGONUCLEOTIDE LINKED TO AN INTERCALATION AGENT, THEIR SYNTHESIS PROCESS AND THEIR APPLICATION|

---

US4605735A|1983-02-14|1986-08-12|Wakunaga Seiyaku Kabushiki Kaisha|Oligonucleotide derivatives|

---

US4948882A|1983-02-22|1990-08-14|Syngene, Inc.|Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis|

---

US4824941A|1983-03-10|1989-04-25|Julian Gordon|Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems|

---

US4587044A|1983-09-01|1986-05-06|The Johns Hopkins University|Linkage of proteins to nucleic acids|

---

US5118802A|1983-12-20|1992-06-02|California Institute Of Technology|DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside|

---

US5550111A|1984-07-11|1996-08-27|Temple University-Of The Commonwealth System Of Higher Education|Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof|

---

US5258506A|1984-10-16|1993-11-02|Chiron Corporation|Photolabile reagents for incorporation into oligonucleotide chains|

---

US5430136A|1984-10-16|1995-07-04|Chiron Corporation|Oligonucleotides having selectably cleavable and/or abasic sites|

---

US5367066A|1984-10-16|1994-11-22|Chiron Corporation|Oligonucleotides with selectably cleavable and/or abasic sites|

---

US4828979A|1984-11-08|1989-05-09|Life Technologies, Inc.|Nucleotide analogs for nucleic acid labeling and detection|

---

FR2575751B1|1985-01-08|1987-04-03|Pasteur Institut|NOVEL ADENOSINE DERIVATIVE NUCLEOSIDES, THEIR PREPARATION AND THEIR BIOLOGICAL APPLICATIONS|

---

US5405938A|1989-12-20|1995-04-11|Anti-Gene Development Group|Sequence-specific binding polymers for duplex nucleic acids|

---

US5034506A|1985-03-15|1991-07-23|Anti-Gene Development Group|Uncharged morpholino-based polymers having achiral intersubunit linkages|

---

US5166315A|1989-12-20|1992-11-24|Anti-Gene Development Group|Sequence-specific binding polymers for duplex nucleic acids|

---

US5185444A|1985-03-15|1993-02-09|Anti-Gene Deveopment Group|Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages|

---

US5235033A|1985-03-15|1993-08-10|Anti-Gene Development Group|Alpha-morpholino ribonucleoside derivatives and polymers thereof|

---

US4762779A|1985-06-13|1988-08-09|Amgen Inc.|Compositions and methods for functionalizing nucleic acids|

---

US5317098A|1986-03-17|1994-05-31|Hiroaki Shizuya|Non-radioisotope tagging of fragments|

---

JPS638396A|1986-06-30|1988-01-14|Wakunaga Pharmaceut Co Ltd|Poly-labeled oligonucleotide derivative|

---

EP0260032B1|1986-09-08|1994-01-26|Ajinomoto Co., Inc.|Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers|

---

US5276019A|1987-03-25|1994-01-04|The United States Of America As Represented By The Department Of Health And Human Services|Inhibitors for replication of retroviruses and for the expression of oncogene products|

---

US5264423A|1987-03-25|1993-11-23|The United States Of America As Represented By The Department Of Health And Human Services|Inhibitors for replication of retroviruses and for the expression of oncogene products|

---

US4904582A|1987-06-11|1990-02-27|Synthetic Genetics|Novel amphiphilic nucleic acid conjugates|

---

DE3851889T2|1987-06-24|1995-04-13|Florey Howard Inst|NUCLEOSIDE DERIVATIVES.|

---

US5585481A|1987-09-21|1996-12-17|Gen-Probe Incorporated|Linking reagents for nucleotide probes|

---

US4924624A|1987-10-22|1990-05-15|Temple University-Of The Commonwealth System Of Higher Education|2,',5'-phosphorothioate oligoadenylates and plant antiviral uses thereof|

---

US5188897A|1987-10-22|1993-02-23|Temple University Of The Commonwealth System Of Higher Education|Encapsulated 2',5'-phosphorothioate oligoadenylates|

---

US5525465A|1987-10-28|1996-06-11|Howard Florey Institute Of Experimental Physiology And Medicine|Oligonucleotide-polyamide conjugates and methods of production and applications of the same|

---

DE3738460A1|1987-11-12|1989-05-24|Max Planck Gesellschaft|MODIFIED OLIGONUCLEOTIDS|

---

EP0348458B1|1987-11-30|1997-04-09|University Of Iowa Research Foundation|Dna molecules stabilized by modifications of the 3'-terminal phosphodiester linkage and their use as nucleic acid probes and as therapeutic agents to block the expression of specifically targeted genes|

---

US5403711A|1987-11-30|1995-04-04|University Of Iowa Research Foundation|Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved|

---

US5082830A|1988-02-26|1992-01-21|Enzo Biochem, Inc.|End labeled nucleotide probe|

---

EP0406309A4|1988-03-25|1992-08-19|The University Of Virginia Alumni Patents Foundation|Oligonucleotide n-alkylphosphoramidates|

---

US5278302A|1988-05-26|1994-01-11|University Patents, Inc.|Polynucleotide phosphorodithioates|

---

US5109124A|1988-06-01|1992-04-28|Biogen, Inc.|Nucleic acid probe linked to a label having a terminal cysteine|

---

US5216141A|1988-06-06|1993-06-01|Benner Steven A|Oligonucleotide analogs containing sulfur linkages|

---

US5175273A|1988-07-01|1992-12-29|Genentech, Inc.|Nucleic acid intercalating agents|

---

US5262536A|1988-09-15|1993-11-16|E. I. Du Pont De Nemours And Company|Reagents for the preparation of 5'-tagged oligonucleotides|

---

US5512439A|1988-11-21|1996-04-30|Dynal As|Oligonucleotide-linked magnetic particles and uses thereof|

---

US5599923A|1989-03-06|1997-02-04|Board Of Regents, University Of Tx|Texaphyrin metal complexes having improved functionalization|

---

US5595726A|1992-01-21|1997-01-21|Pharmacyclics, Inc.|Chromophore probe for detection of nucleic acid|

---

US5565552A|1992-01-21|1996-10-15|Pharmacyclics, Inc.|Method of expanded porphyrin-oligonucleotide conjugate synthesis|

---

US5457183A|1989-03-06|1995-10-10|Board Of Regents, The University Of Texas System|Hydroxylated texaphyrins|

---

US5391723A|1989-05-31|1995-02-21|Neorx Corporation|Oligonucleotide conjugates|

---

US5256775A|1989-06-05|1993-10-26|Gilead Sciences, Inc.|Exonuclease-resistant oligonucleotides|

---

US4958013A|1989-06-06|1990-09-18|Northwestern University|Cholesteryl modified oligonucleotides|

---

US5451463A|1989-08-28|1995-09-19|Clontech Laboratories, Inc.|Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides|

---

US5134066A|1989-08-29|1992-07-28|Monsanto Company|Improved probes using nucleosides containing 3-dezauracil analogs|

---

US5254469A|1989-09-12|1993-10-19|Eastman Kodak Company|Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures|

---

US5399676A|1989-10-23|1995-03-21|Gilead Sciences|Oligonucleotides with inverted polarity|

---

US5264564A|1989-10-24|1993-11-23|Gilead Sciences|Oligonucleotide analogs with novel linkages|

---

US5264562A|1989-10-24|1993-11-23|Gilead Sciences, Inc.|Oligonucleotide analogs with novel linkages|

---

US5292873A|1989-11-29|1994-03-08|The Research Foundation Of State University Of New York|Nucleic acids labeled with naphthoquinone probe|

---

US5177198A|1989-11-30|1993-01-05|University Of N.C. At Chapel Hill|Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates|

---

US5130302A|1989-12-20|1992-07-14|Boron Bilogicals, Inc.|Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same|

---

US5486603A|1990-01-08|1996-01-23|Gilead Sciences, Inc.|Oligonucleotide having enhanced binding affinity|

---

US5578718A|1990-01-11|1996-11-26|Isis Pharmaceuticals, Inc.|Thiol-derivatized nucleosides|

---

US5587470A|1990-01-11|1996-12-24|Isis Pharmaceuticals, Inc.|3-deazapurines|

---

US5681941A|1990-01-11|1997-10-28|Isis Pharmaceuticals, Inc.|Substituted purines and oligonucleotide cross-linking|

---

US5459255A|1990-01-11|1995-10-17|Isis Pharmaceuticals, Inc.|N-2 substituted purines|

---

US5587361A|1991-10-15|1996-12-24|Isis Pharmaceuticals, Inc.|Oligonucleotides having phosphorothioate linkages of high chiral purity|

---

US5220007A|1990-02-15|1993-06-15|The Worcester Foundation For Experimental Biology|Method of site-specific alteration of RNA and production of encoded polypeptides|

---

US5149797A|1990-02-15|1992-09-22|The Worcester Foundation For Experimental Biology|Method of site-specific alteration of rna and production of encoded polypeptides|

---

WO1991013080A1|1990-02-20|1991-09-05|Gilead Sciences, Inc.|Pseudonucleosides and pseudonucleotides and their polymers|

---

US5214136A|1990-02-20|1993-05-25|Gilead Sciences, Inc.|Anthraquinone-derivatives oligonucleotides|

---

US5321131A|1990-03-08|1994-06-14|Hybridon, Inc.|Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling|

---

US5470967A|1990-04-10|1995-11-28|The Dupont Merck Pharmaceutical Company|Oligonucleotide analogs with sulfamate linkages|

---

DE69032425T2|1990-05-11|1998-11-26|Microprobe Corp|Immersion test strips for nucleic acid hybridization assays and methods for covalently immobilizing oligonucleotides|

---

US5677437A|1990-07-27|1997-10-14|Isis Pharmaceuticals, Inc.|Heteroatomic oligonucleoside linkages|

---

US5623070A|1990-07-27|1997-04-22|Isis Pharmaceuticals, Inc.|Heteroatomic oligonucleoside linkages|

---

US5138045A|1990-07-27|1992-08-11|Isis Pharmaceuticals|Polyamine conjugated oligonucleotides|

---

US5218105A|1990-07-27|1993-06-08|Isis Pharmaceuticals|Polyamine conjugated oligonucleotides|

---

US5610289A|1990-07-27|1997-03-11|Isis Pharmaceuticals, Inc.|Backbone modified oligonucleotide analogues|

---

US5614617A|1990-07-27|1997-03-25|Isis Pharmaceuticals, Inc.|Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression|

---

US5489677A|1990-07-27|1996-02-06|Isis Pharmaceuticals, Inc.|Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms|

---

US5541307A|1990-07-27|1996-07-30|Isis Pharmaceuticals, Inc.|Backbone modified oligonucleotide analogs and solid phase synthesis thereof|

---

US5688941A|1990-07-27|1997-11-18|Isis Pharmaceuticals, Inc.|Methods of making conjugated 4' desmethyl nucleoside analog compounds|

---

US5602240A|1990-07-27|1997-02-11|Ciba Geigy Ag.|Backbone modified oligonucleotide analogs|

---

US5618704A|1990-07-27|1997-04-08|Isis Pharmacueticals, Inc.|Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling|

---

US5608046A|1990-07-27|1997-03-04|Isis Pharmaceuticals, Inc.|Conjugated 4'-desmethyl nucleoside analog compounds|

---

US5245022A|1990-08-03|1993-09-14|Sterling Drug, Inc.|Exonuclease resistant terminally substituted oligonucleotides|

---

EP0541722B1|1990-08-03|1995-12-20|Sterling Winthrop Inc.|Compounds and methods for inhibiting gene expression|

---

US5623065A|1990-08-13|1997-04-22|Isis Pharmaceuticals, Inc.|Gapped 2' modified oligonucleotides|

---

US5177196A|1990-08-16|1993-01-05|Microprobe Corporation|Oligo and α-arabinofuranosyl precursors thereof|

---

US5512667A|1990-08-28|1996-04-30|Reed; Michael W.|Trifunctional intermediates for preparing 3'-tailed oligonucleotides|

---

US5214134A|1990-09-12|1993-05-25|Sterling Winthrop Inc.|Process of linking nucleosides with a siloxane bridge|

---

US5561225A|1990-09-19|1996-10-01|Southern Research Institute|Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages|

---

US5596086A|1990-09-20|1997-01-21|Gilead Sciences, Inc.|Modified internucleoside linkages having one nitrogen and two carbon atoms|

---

US5432272A|1990-10-09|1995-07-11|Benner; Steven A.|Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases|

---

EP0556301B1|1990-11-08|2001-01-10|Hybridon, Inc.|Incorporation of multiple reporter groups on synthetic oligonucleotides|

---

US5719262A|1993-11-22|1998-02-17|Buchardt, Deceased; Ole|Peptide nucleic acids having amino acid side chains|

---

US5714331A|1991-05-24|1998-02-03|Buchardt, Deceased; Ole|Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility|

---

US5371241A|1991-07-19|1994-12-06|Pharmacia P-L Biochemicals Inc.|Fluorescein labelled phosphoramidites|

---

US5571799A|1991-08-12|1996-11-05|Basco, Ltd.| oligoadenylate analogues useful as inhibitors of host-v5.-graft response|

---

US5484908A|1991-11-26|1996-01-16|Gilead Sciences, Inc.|Oligonucleotides containing 5-propynyl pyrimidines|

---

US5700922A|1991-12-24|1997-12-23|Isis Pharmaceuticals, Inc.|PNA-DNA-PNA chimeric macromolecules|

---

US5633360A|1992-04-14|1997-05-27|Gilead Sciences, Inc.|Oligonucleotide analogs capable of passive cell membrane permeation|

---

US5434257A|1992-06-01|1995-07-18|Gilead Sciences, Inc.|Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages|

---

US5272250A|1992-07-10|1993-12-21|Spielvogel Bernard F|Boronated phosphoramidate compounds|

---

US5652355A|1992-07-23|1997-07-29|Worcester Foundation For Experimental Biology|Hybrid oligonucleotide phosphorothioates|

---

US5574142A|1992-12-15|1996-11-12|Microprobe Corporation|Peptide linkers for improved oligonucleotide delivery|

---

US5476925A|1993-02-01|1995-12-19|Northwestern University|Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups|

---

GB9304618D0|1993-03-06|1993-04-21|Ciba Geigy Ag|Chemical compounds|

---

DE69407032T2|1993-03-31|1998-07-02|Sanofi Sa|OLIGONUCLEOTIDES WITH AMIDE CHAINS USE THE PHOSPHOESTER CHAINS|

---

US5539082A|1993-04-26|1996-07-23|Nielsen; Peter E.|Peptide nucleic acids|

---

US5502177A|1993-09-17|1996-03-26|Gilead Sciences, Inc.|Pyrimidine derivatives for labeled binding partners|

---

US5457187A|1993-12-08|1995-10-10|Board Of Regents University Of Nebraska|Oligonucleotides containing 5-fluorouracil|

---

CN1048254C|1993-12-09|2000-01-12|托马斯杰弗逊大学|Compounds and methods for site-directed mutations in eukaryotic cells|

---

US5596091A|1994-03-18|1997-01-21|The Regents Of The University Of California|Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides|

---

US5625050A|1994-03-31|1997-04-29|Amgen Inc.|Modified oligonucleotides and intermediates useful in nucleic acid therapeutics|

---

US5525711A|1994-05-18|1996-06-11|The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services|Pteridine nucleotide analogs as fluorescent DNA probes|

---

US5597696A|1994-07-18|1997-01-28|Becton Dickinson And Company|Covalent cyanine dye oligonucleotide conjugates|

---

US5580731A|1994-08-25|1996-12-03|Chiron Corporation|N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith|

---

US6007839A|1996-02-16|1999-12-28|The Liposome Company, Inc.|Preparation of pharmaceutical compositions containing etherlipid-containing multiple lipid liposomes|

---

US5716928A|1995-06-07|1998-02-10|Avmax, Inc.|Use of essential oils to increase bioavailability of oral pharmaceutical compounds|

---

US5652356A|1995-08-17|1997-07-29|Hybridon, Inc.|Inverted chimeric and hybrid oligonucleotides|

---

US5858401A|1996-01-22|1999-01-12|Sidmak Laboratories, Inc.|Pharmaceutical composition for cyclosporines|

---

WO1997045069A1|1996-05-29|1997-12-04|Cell Genesys, Inc.|Cationic polymer/lipid nucleic acid delivery vehicles|

---

JP2001511821A|1997-06-05|2001-08-14|シューベルト、バルター|Use of substances with immunomodulatory activity for the treatment of amyotrophic lateral sclerosis|

---

US6770748B2|1997-03-07|2004-08-03|Takeshi Imanishi|Bicyclonucleoside and oligonucleotide analogue|

---

JP3756313B2|1997-03-07|2006-03-15|武 今西|Novel bicyclonucleosides and oligonucleotide analogues|

---

US6630137B1|1997-04-28|2003-10-07|Eli Lilly And Company|Activated protein C formulations|

---

AU8285998A|1997-07-02|1999-01-25|Sdg, Inc.|Targeted liposomal constructs for diagnostic and therapeutic uses|

---

US6794499B2|1997-09-12|2004-09-21|Exiqon A/S|Oligonucleotide analogues|

---

US7572582B2|1997-09-12|2009-08-11|Exiqon A/S|Oligonucleotide analogues|

---

US7087648B1|1997-10-27|2006-08-08|The Regents Of The University Of California|Methods for modulating macrophage proliferation using polyamine analogs|

---

US7084125B2|1999-03-18|2006-08-01|Exiqon A/S|Xylo-LNA analogues|

---

US6734291B2|1999-03-24|2004-05-11|Exiqon A/S|Synthesis of [2.2.1]bicyclo nucleosides|

---

DE60033927T2|1999-05-04|2007-11-29|Santaris Pharma A/S|L-RIBO-LNA ANALOGUE|

---

PT1194167E|1999-06-09|2009-10-23|Immunomedics Inc|Immunotherapy of autoimmune disorders using antibodies which target b-cells|

---

US6287860B1|2000-01-20|2001-09-11|Isis Pharmaceuticals, Inc.|Antisense inhibition of MEKK2 expression|

---

CA2459347C|2001-09-04|2012-10-09|Exiqon A/S|Locked nucleic acid compositions and uses thereof|

---

JP2005510524A|2001-11-16|2005-04-21|アルス・セラピー・デベロツプメント・フアンデーシヨン・インコーポレーテツド|Treatment of neurodegenerative disorders by modulating the polyamine pathway|

---

AT442152T|2002-11-18|2009-09-15|Santaris Pharma As|Antisense DRAFT|

---

DK2141234T3|2003-03-21|2016-06-20|Roche Innovation Ct Copenhagen As|Short interfering RNA analogues|

---

DK1713912T3|2004-01-30|2013-12-16|Santaris Pharma As|Modified Short Interfering RNA |

---

EP1648914A4|2003-07-31|2009-12-16|Regulus Therapeutics Inc|Oligomeric compounds and compositions for use in modulation of small non-coding rnas|

---

AU2004303464B2|2003-12-23|2009-10-01|Santaris Pharma A/S|Oligomeric compounds for the modulation of BCL-2|

---

WO2005079397A2|2004-02-13|2005-09-01|Rockefeller University|Anti-microrna oligonucleotide molecules|

---

EP1781593B1|2004-06-07|2011-12-14|Protiva Biotherapeutics Inc.|Cationic lipids and methods of use|

---

US7618947B2|2004-08-25|2009-11-17|Isis Pharmaceuticals, Inc.|Modulation of HIF-1 beta expression|

---

BRPI0517613A|2004-11-09|2008-10-14|Santaris Pharma As|oligonucleotides lna and cancer treatment|

---

US20070099196A1|2004-12-29|2007-05-03|Sakari Kauppinen|Novel oligonucleotide compositions and probe sequences useful for detection and analysis of micrornas and their target mRNAs|

---

CA2649045C|2006-04-03|2019-06-11|Santaris Pharma A/S|Pharmaceutical composition comprising anti-mirna antisense oligonucleotides|

---

PL2666859T3|2006-04-03|2019-09-30|Roche Innovation Center Copenhagen A/S|Pharmaceutical composition comprising anti-mirna antisense oligonucleotides|

---

US8338376B2|2006-10-20|2012-12-25|Biogen Idec Ma Inc.|Compositions comprising variant LT-B-R-IG fusion proteins|

---

US8048998B2|2007-01-19|2011-11-01|Exiqon A/S|Mediated cellular delivery of LNA oligonucleotides|

---

PE20090064A1|2007-03-26|2009-03-02|Novartis Ag|DOUBLE-CHAIN RIBONUCLEIC ACID TO INHIBIT THE EXPRESSION OF THE HUMAN E6AP GENE AND THE PHARMACEUTICAL COMPOSITION THAT INCLUDES IT|

---

KR100794449B1|2007-03-29|2008-01-16|고려대학교 산학협력단|Composition of cationic phospho lipid nanoparticles for effective delivery of nucleic acids|

---

WO2008153692A2|2007-05-22|2008-12-18|The Brigham And Women's Hospital, Inc.|Microrna expression profiling of cerebrospinal fluid|

---

WO2008151631A2|2007-06-15|2008-12-18|Exiqon A/S|Use of short oligonucleotides for reagent redundancy experiments in rna functional analysis|

---

CA2735166C|2007-08-27|2020-12-01|Boston Biomedical, Inc.|Compositions of asymmetric interfering rna and uses thereof|

---

KR100807060B1|2007-08-28|2008-02-25|고려대학교 산학협력단|A novel cationic lipid, a preparation method of the same and a delivery system comprising the same|

---

ES2463665T3|2007-10-04|2014-05-28|Stella Aps|Combination treatment for the treatment of hepatitis C virus infection|

---

GB0720486D0|2007-10-19|2007-11-28|Univ Edinburgh|Cationic lipids|

---

ES2456990T3|2007-11-26|2014-04-24|Santaris Pharma A/S|LNA-based antagonists targeting the androgen receptor|

---

FR2925491B1|2007-12-19|2010-09-03|Oz Biosciences Sas|NEW CLASSES OF CATIONIC LIPIDS FOR THE TRANSPORT OF ACTIVE AGENTS IN CELLS|

---

US8361980B2|2008-03-07|2013-01-29|Santaris Pharma A/S|Pharmaceutical compositions for treatment of microRNA related diseases|

---

US8202848B2|2008-03-17|2012-06-19|Board Of Regents, The University Of Texas System|Identification of micro-RNAS involved in neuromuscular synapse maintenance and regeneration|

---

US20100104629A1|2008-04-16|2010-04-29|Abbott Laboratories|Cationic lipids and uses thereof|

---

KR101770435B1|2008-10-03|2017-09-05|큐알엔에이, 인크.|Treatment of apolipoprotein-a1 related diseases by inhibition of natural antisense transcript to apolipoproteina1|

---

EP2364085A4|2008-11-17|2012-12-12|Enzon Pharmaceuticals Inc|Releasable cationic lipids for nucleic acids delivery systems|

---

EP2350296A4|2008-11-17|2013-04-03|Enzon Pharmaceuticals Inc|Branched cationic lipids for nucleic acids delivery system|

---

WO2010129746A2|2009-05-06|2010-11-11|Curna, Inc.|Treatment of tristetraproline related diseases by inhibition of natural antisense transcript to ttp|

---

US9364495B2|2009-10-20|2016-06-14|Roche Innovation Center Copenhagen A/S|Oral delivery of therapeutically effective LNA oligonucleotides|

---

US20110142789A1|2009-12-10|2011-06-16|The Trustees Of The University Of Pennsylvania|Compositions and Methods for the Diagnosis and Treatment of Amyotrophic Lateral Sclerosis|

---

US20120064122A1|2010-09-13|2012-03-15|David Baltimore|Treatment of autoimmune inflammation using mir-155|

---

WO2013080784A1|2011-11-30|2013-06-06|シャープ株式会社|Memory circuit, drive method for same, nonvolatile storage device using same, and liquid crystal display device|

---

WO2013134403A1|2012-03-06|2013-09-12|The Washington University|Method of treating neurodegenerative diseases with microrna regulators|

---

JP6220776B2|2012-03-09|2017-10-25|テイ・エス テック株式会社|Seat mounting structure|

---

CA2986913A1|2015-06-05|2016-12-08|MiRagen Therapeutics, Inc.|Mir-155 inhibitors for treating amyotrophic lateral sclerosis |US9217155B2|2008-05-28|2015-12-22|University Of Massachusetts|Isolation of novel AAV'S and uses thereof|

---

WO2010138263A2|2009-05-28|2010-12-02|University Of Massachusetts|Novel aav 's and uses thereof|

---

EP2561073B1|2010-04-23|2016-08-24|University of Massachusetts|Cns targeting aav vectors and methods of use thereof|

---

WO2011133874A1|2010-04-23|2011-10-27|University Of Massachusetts|Multicistronic expression constructs|

---

EP2731422B1|2011-07-12|2017-08-09|Mart Saarma|miRNA antagonists for use in treating neurodegenerative disorders by increasing expression of GDNF|

---

JP2014128249A|2012-12-28|2014-07-10|Hokkaido Univ|USE OF miRNA OR TARGET GENE THEREOF IN INSPECTION AND THERAPY OF NEURODEGENERATIVE DISEASE|

---

JP6541049B2|2014-01-16|2019-07-10|国立大学法人北海道大学|Biomarkers for amyotrophic lateral sclerosis|

---

US10072251B2|2014-02-19|2018-09-11|University Of Massachusetts|Recombinant AAVS having useful transcytosis properties|

---

CA2942515A1|2014-03-18|2015-09-24|University Of Massachusetts|Raav-based compositions and methods for treating amyotrophic lateral sclerosis|

---

EP3134522B1|2014-04-25|2021-10-06|University of Massachusetts|Recombinant aav vectors useful for reducing immunity against transgene products|

---

WO2015187825A2|2014-06-03|2015-12-10|University Of Massachusetts|Compositions and methods for modulating dysferlin expression|

---

US10627392B2|2014-06-17|2020-04-21|Stealth Biotherapeutics Corp|Methods of identifying and monitoring mitochondrial dysfunction using monocyte screening|

---

WO2016054554A1|2014-10-03|2016-04-07|University Of Massachusetts|Heterologous targeting peptide grafted aavs|

---

JP6842410B2|2014-10-03|2021-03-17|ユニバーシティ オブ マサチューセッツ|AAV vector identified by a novel high efficiency library|

---

WO2016065001A1|2014-10-21|2016-04-28|University Of Massachusetts|Recombinant aav variants and uses thereof|

---

EP3256170B1|2015-02-13|2020-09-23|University of Massachusetts|Compositions and methods for transient delivery of nucleases|

---

WO2016138287A1|2015-02-25|2016-09-01|Washington University|METHODS TO DETECT MOTOR NEURON DISEASE COMPRISING MICRO-RNAs|

---

JP2016198021A|2015-04-08|2016-12-01|国立大学法人北海道大学|Method of assisting detection of amyotrophic lateral sclerosis and therapeutic agent|

---

CN104826131B|2015-04-15|2018-12-18|涛康生物科技（上海）有限公司|Purposes of the miR-17-92 gene cluster in preparation treatment mental disorder drug|

---

CA3021949A1|2015-04-24|2016-10-27|University Of Massachusetts|Modified aav constructs and uses thereof|

---

KR102034619B1|2015-06-05|2019-11-11|미라젠 세러퓨틱스 인코포레이티드|MIR-155 inhibitor for the treatment of cutaneous T cell lymphoma |

---

CA2986913A1|2015-06-05|2016-12-08|MiRagen Therapeutics, Inc.|Mir-155 inhibitors for treating amyotrophic lateral sclerosis |

---

US10441601B2|2015-06-30|2019-10-15|St. Jude Children's Research Hospital, Inc.|Method for treating schizophrenia|

---

KR101723826B1|2015-07-14|2017-04-06|한국과학기술연구원|Bio-marker for drug addiction diagnosis and kit for drug addiction diagnosis|

---

CA3002982A1|2015-10-22|2017-04-27|University Of Massachusetts|Methods and compositions for treating metabolic imbalance in neurodegenerative disease|

---

EP3413928A4|2016-02-12|2019-11-20|University of Massachusetts|Anti-angiogenic mirna therapeutics for inhibiting corneal neovascularization|

---

US11207426B2|2016-04-05|2021-12-28|University Of Massachusetts|Compositions and methods for selective inhibition of grainyhead-like protein expression|

---

WO2017177028A1|2016-04-06|2017-10-12|Duke University|Compositions and methods for blood storage|

---

WO2017196872A1|2016-05-09|2017-11-16|Wayne State University|Orthogonal approach to integrate independent omic data|

---

WO2017214471A1|2016-06-10|2017-12-14|Saunders, Ann M.|Methods for detecting structural variants in neurodegenerative disease|

---

CN105861728A|2016-06-12|2016-08-17|上海市第十人民医院|Application of circulating miRNA in serving as age-related macular degeneration diagnostic markers|

---

CN106620718B|2016-08-30|2019-11-05|广东医科大学|PF-127-miRNA-615 agomir compound and its preparation method and application|

---

US10457940B2|2016-09-22|2019-10-29|University Of Massachusetts|AAV treatment of Huntington's disease|

---

WO2018236590A1|2017-06-19|2018-12-27|St. John's University|Circulating serum microrna biomarkers and methods for determining the progression rate of parkinson's disease|

---

US11078535B2|2017-07-18|2021-08-03|The Trustees Of Indiana University|Presymptomatic micro RNA targets for treatment of neurodegeneration pathology|

---

KR101956315B1|2017-07-19|2019-03-08|국민대학교 산학협력단|miR494 as a biomarker for parkinson’s disease and diagnostic kit using thereof|

---

KR102177130B1|2017-08-18|2020-11-10|큐라미스|Use of miR-18b for preventing, treating or diagnosing muscular disease and neuromuscular disease|

---

WO2019116412A1|2017-12-15|2019-06-20|Istituto Superiore Di Sanita'|Method for in vitro diagnosis of amyotrophic lateral sclerosis|

---

KR102361394B1|2017-12-28|2022-02-14|재단법인 대구경북과학기술원|miRNA associated with epilepsy and uses thereof|

---

KR102248910B1|2017-12-28|2021-05-06|재단법인대구경북과학기술원|miRNA associated with epilepsy and uses thereof|

---

CN112469475A|2018-04-20|2021-03-09|泰莱托恩基金会|miR-181 inhibitor and application thereof|

---

WO2020171889A1|2019-02-19|2020-08-27|University Of Rochester|Blocking lipid accumulation or inflammation in thyroid eye disease|

---

GB201909619D0|2019-07-04|2019-08-21|Univ Oxford Innovation Ltd|Methods for diagnosing multiple sclerosis|

---

WO2021067613A1|2019-10-01|2021-04-08|Children's Medical Center Corporation|Compositions and methods for treating amyotrophic lateral sclerosis|

---

CN111727260A|2019-10-15|2020-09-29|湖南乾康科技有限公司|Application of intermediate monocyte in preparation of drugs for diagnosing and predicting AD|

---

WO2021113394A2|2019-12-02|2021-06-10|The Institute for Ethnomedicine dba Brain Chemistry Labs|Methods of detection and analysis of nucleic acid in neural-derived exosomes|

法律状态:
2020-11-03| B11A| Dismissal acc. art.33 of ipl - examination not requested within 36 months of filing|

---

2021-01-19| B11Y| Definitive dismissal - extension of time limit for request of examination expired [chapter 11.1.1 patent gazette]|

---

2021-12-07| B350| Update of information on the portal [chapter 15.35 patent gazette]|

优先权:

---

申请号 | 申请日 | 专利标题

---

US201161545968P| true| 2011-10-11|2011-10-11|

---

US61/545,968|2011-10-11|

---

US201261601205P| true| 2012-02-21|2012-02-21|

---

US61/601,205|2012-02-21|

---

PCT/US2012/059671|WO2013055865A1|2011-10-11|2012-10-11|Micrornas in neurodegenerative disorders|

---